ID: 985551280

View in Genome Browser
Species Human (GRCh38)
Location 5:534809-534831
Sequence AGGTCAGCACCCCCATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551274_985551280 11 Left 985551274 5:534775-534797 CCTGCGAGAAAACCCAGAGCGGA No data
Right 985551280 5:534809-534831 AGGTCAGCACCCCCATAGGAAGG No data
985551272_985551280 18 Left 985551272 5:534768-534790 CCAGACTCCTGCGAGAAAACCCA No data
Right 985551280 5:534809-534831 AGGTCAGCACCCCCATAGGAAGG No data
985551277_985551280 -2 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551280 5:534809-534831 AGGTCAGCACCCCCATAGGAAGG No data
985551276_985551280 -1 Left 985551276 5:534787-534809 CCCAGAGCGGAAGTGAGGACTCA No data
Right 985551280 5:534809-534831 AGGTCAGCACCCCCATAGGAAGG No data
985551271_985551280 30 Left 985551271 5:534756-534778 CCAGCTGCTTGTCCAGACTCCTG No data
Right 985551280 5:534809-534831 AGGTCAGCACCCCCATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551280 Original CRISPR AGGTCAGCACCCCCATAGGA AGG Intergenic
No off target data available for this crispr