ID: 985551285

View in Genome Browser
Species Human (GRCh38)
Location 5:534818-534840
Sequence CCCCCATAGGAAGGGGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551277_985551285 7 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551285 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data
985551276_985551285 8 Left 985551276 5:534787-534809 CCCAGAGCGGAAGTGAGGACTCA No data
Right 985551285 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data
985551272_985551285 27 Left 985551272 5:534768-534790 CCAGACTCCTGCGAGAAAACCCA No data
Right 985551285 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data
985551274_985551285 20 Left 985551274 5:534775-534797 CCTGCGAGAAAACCCAGAGCGGA No data
Right 985551285 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551285 Original CRISPR CCCCCATAGGAAGGGGGACC CGG Intergenic
No off target data available for this crispr