ID: 985551290

View in Genome Browser
Species Human (GRCh38)
Location 5:534821-534843
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551290_985551300 24 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551300 5:534868-534890 TTCCTCAGCAGTGCTGTGGGTGG No data
985551290_985551296 -6 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551296 5:534838-534860 CGGGGTGGACGCGGAGCTGAGGG No data
985551290_985551298 20 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551298 5:534864-534886 GGCATTCCTCAGCAGTGCTGTGG No data
985551290_985551295 -7 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551290_985551299 21 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data
985551290_985551297 -1 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551297 5:534843-534865 TGGACGCGGAGCTGAGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551290 Original CRISPR ACCCCGGGTCCCCCTTCCTA TGG (reversed) Intergenic
No off target data available for this crispr