ID: 985551291

View in Genome Browser
Species Human (GRCh38)
Location 5:534823-534845
Sequence ATAGGAAGGGGGACCCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551277_985551291 12 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551291 5:534823-534845 ATAGGAAGGGGGACCCGGGGTGG No data
985551274_985551291 25 Left 985551274 5:534775-534797 CCTGCGAGAAAACCCAGAGCGGA No data
Right 985551291 5:534823-534845 ATAGGAAGGGGGACCCGGGGTGG No data
985551276_985551291 13 Left 985551276 5:534787-534809 CCCAGAGCGGAAGTGAGGACTCA No data
Right 985551291 5:534823-534845 ATAGGAAGGGGGACCCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551291 Original CRISPR ATAGGAAGGGGGACCCGGGG TGG Intergenic
No off target data available for this crispr