ID: 985551292

View in Genome Browser
Species Human (GRCh38)
Location 5:534829-534851
Sequence AGGGGGACCCGGGGTGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551276_985551292 19 Left 985551276 5:534787-534809 CCCAGAGCGGAAGTGAGGACTCA No data
Right 985551292 5:534829-534851 AGGGGGACCCGGGGTGGACGCGG No data
985551277_985551292 18 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551292 5:534829-534851 AGGGGGACCCGGGGTGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551292 Original CRISPR AGGGGGACCCGGGGTGGACG CGG Intergenic
No off target data available for this crispr