ID: 985551295

View in Genome Browser
Species Human (GRCh38)
Location 5:534837-534859
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551286_985551295 -5 Left 985551286 5:534819-534841 CCCCATAGGAAGGGGGACCCGGG No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551284_985551295 -4 Left 985551284 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551288_985551295 -6 Left 985551288 5:534820-534842 CCCATAGGAAGGGGGACCCGGGG No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551290_985551295 -7 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551277_985551295 26 Left 985551277 5:534788-534810 CCAGAGCGGAAGTGAGGACTCAG No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
985551276_985551295 27 Left 985551276 5:534787-534809 CCCAGAGCGGAAGTGAGGACTCA No data
Right 985551295 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr