ID: 985551297

View in Genome Browser
Species Human (GRCh38)
Location 5:534843-534865
Sequence TGGACGCGGAGCTGAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551290_985551297 -1 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551297 5:534843-534865 TGGACGCGGAGCTGAGGGAATGG No data
985551286_985551297 1 Left 985551286 5:534819-534841 CCCCATAGGAAGGGGGACCCGGG No data
Right 985551297 5:534843-534865 TGGACGCGGAGCTGAGGGAATGG No data
985551288_985551297 0 Left 985551288 5:534820-534842 CCCATAGGAAGGGGGACCCGGGG No data
Right 985551297 5:534843-534865 TGGACGCGGAGCTGAGGGAATGG No data
985551284_985551297 2 Left 985551284 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data
Right 985551297 5:534843-534865 TGGACGCGGAGCTGAGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551297 Original CRISPR TGGACGCGGAGCTGAGGGAA TGG Intergenic
No off target data available for this crispr