ID: 985551299

View in Genome Browser
Species Human (GRCh38)
Location 5:534865-534887
Sequence GCATTCCTCAGCAGTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985551293_985551299 6 Left 985551293 5:534836-534858 CCCGGGGTGGACGCGGAGCTGAG No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data
985551286_985551299 23 Left 985551286 5:534819-534841 CCCCATAGGAAGGGGGACCCGGG No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data
985551288_985551299 22 Left 985551288 5:534820-534842 CCCATAGGAAGGGGGACCCGGGG No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data
985551284_985551299 24 Left 985551284 5:534818-534840 CCCCCATAGGAAGGGGGACCCGG No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data
985551290_985551299 21 Left 985551290 5:534821-534843 CCATAGGAAGGGGGACCCGGGGT No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data
985551294_985551299 5 Left 985551294 5:534837-534859 CCGGGGTGGACGCGGAGCTGAGG No data
Right 985551299 5:534865-534887 GCATTCCTCAGCAGTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985551299 Original CRISPR GCATTCCTCAGCAGTGCTGT GGG Intergenic
No off target data available for this crispr