ID: 985552807

View in Genome Browser
Species Human (GRCh38)
Location 5:541836-541858
Sequence CAGGCAAGGGACGGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985552794_985552807 16 Left 985552794 5:541797-541819 CCCTAGGCTGACCCCGGGAGGGA No data
Right 985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG No data
985552797_985552807 4 Left 985552797 5:541809-541831 CCCGGGAGGGAGCATCACCCTCA No data
Right 985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG No data
985552795_985552807 15 Left 985552795 5:541798-541820 CCTAGGCTGACCCCGGGAGGGAG No data
Right 985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG No data
985552796_985552807 5 Left 985552796 5:541808-541830 CCCCGGGAGGGAGCATCACCCTC No data
Right 985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG No data
985552789_985552807 22 Left 985552789 5:541791-541813 CCGGGGCCCTAGGCTGACCCCGG No data
Right 985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG No data
985552798_985552807 3 Left 985552798 5:541810-541832 CCGGGAGGGAGCATCACCCTCAG No data
Right 985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985552807 Original CRISPR CAGGCAAGGGACGGGGCTGC TGG Intergenic
No off target data available for this crispr