ID: 985553470

View in Genome Browser
Species Human (GRCh38)
Location 5:544678-544700
Sequence GGCCAATGCTCTTGGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985553463_985553470 -5 Left 985553463 5:544660-544682 CCAGGAGACCACCAGGGAGGCCA No data
Right 985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG No data
985553458_985553470 6 Left 985553458 5:544649-544671 CCCAAACAGGGCCAGGAGACCAC No data
Right 985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG No data
985553459_985553470 5 Left 985553459 5:544650-544672 CCAAACAGGGCCAGGAGACCACC No data
Right 985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG No data
985553454_985553470 23 Left 985553454 5:544632-544654 CCTGGTGAGACACAAAACCCAAA No data
Right 985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985553470 Original CRISPR GGCCAATGCTCTTGGGGTGT GGG Intergenic
No off target data available for this crispr