ID: 985554963

View in Genome Browser
Species Human (GRCh38)
Location 5:554128-554150
Sequence GGCAAGCGGCATAGGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985554963_985554974 13 Left 985554963 5:554128-554150 CCCTGGCCCCTATGCCGCTTGCC No data
Right 985554974 5:554164-554186 GGGTGATTGTAGCATTTTTATGG No data
985554963_985554971 -7 Left 985554963 5:554128-554150 CCCTGGCCCCTATGCCGCTTGCC No data
Right 985554971 5:554144-554166 GCTTGCCAGGTTCACCTTCAGGG No data
985554963_985554970 -8 Left 985554963 5:554128-554150 CCCTGGCCCCTATGCCGCTTGCC No data
Right 985554970 5:554143-554165 CGCTTGCCAGGTTCACCTTCAGG No data
985554963_985554975 18 Left 985554963 5:554128-554150 CCCTGGCCCCTATGCCGCTTGCC No data
Right 985554975 5:554169-554191 ATTGTAGCATTTTTATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985554963 Original CRISPR GGCAAGCGGCATAGGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr