ID: 985555290

View in Genome Browser
Species Human (GRCh38)
Location 5:555148-555170
Sequence CCCAGCCAGGTCACGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985555290_985555297 2 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555297 5:555173-555195 TGCTTAACTTATGAGCAGTTCGG No data
985555290_985555301 21 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555301 5:555192-555214 TCGGCTTCCTCGCGGGCGCCGGG No data
985555290_985555302 22 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555302 5:555193-555215 CGGCTTCCTCGCGGGCGCCGGGG No data
985555290_985555298 13 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555298 5:555184-555206 TGAGCAGTTCGGCTTCCTCGCGG No data
985555290_985555299 14 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555299 5:555185-555207 GAGCAGTTCGGCTTCCTCGCGGG No data
985555290_985555303 25 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555290_985555300 20 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555300 5:555191-555213 TTCGGCTTCCTCGCGGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985555290 Original CRISPR CCCAGCCAGGTCACGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr