ID: 985555293

View in Genome Browser
Species Human (GRCh38)
Location 5:555153-555175
Sequence GCAGCCCCAGCCAGGTCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985555293_985555301 16 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555301 5:555192-555214 TCGGCTTCCTCGCGGGCGCCGGG No data
985555293_985555300 15 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555300 5:555191-555213 TTCGGCTTCCTCGCGGGCGCCGG No data
985555293_985555298 8 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555298 5:555184-555206 TGAGCAGTTCGGCTTCCTCGCGG No data
985555293_985555299 9 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555299 5:555185-555207 GAGCAGTTCGGCTTCCTCGCGGG No data
985555293_985555302 17 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555302 5:555193-555215 CGGCTTCCTCGCGGGCGCCGGGG No data
985555293_985555303 20 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555293_985555297 -3 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555297 5:555173-555195 TGCTTAACTTATGAGCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985555293 Original CRISPR GCAGCCCCAGCCAGGTCACG GGG (reversed) Intergenic
No off target data available for this crispr