ID: 985555296

View in Genome Browser
Species Human (GRCh38)
Location 5:555161-555183
Sequence TAAGTTAAGCAGCCCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985555296_985555301 8 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555301 5:555192-555214 TCGGCTTCCTCGCGGGCGCCGGG No data
985555296_985555302 9 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555302 5:555193-555215 CGGCTTCCTCGCGGGCGCCGGGG No data
985555296_985555299 1 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555299 5:555185-555207 GAGCAGTTCGGCTTCCTCGCGGG No data
985555296_985555303 12 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555296_985555300 7 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555300 5:555191-555213 TTCGGCTTCCTCGCGGGCGCCGG No data
985555296_985555298 0 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555298 5:555184-555206 TGAGCAGTTCGGCTTCCTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985555296 Original CRISPR TAAGTTAAGCAGCCCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr