ID: 985555303

View in Genome Browser
Species Human (GRCh38)
Location 5:555196-555218
Sequence CTTCCTCGCGGGCGCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985555294_985555303 19 Left 985555294 5:555154-555176 CCCGTGACCTGGCTGGGGCTGCT No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555296_985555303 12 Left 985555296 5:555161-555183 CCTGGCTGGGGCTGCTTAACTTA No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555295_985555303 18 Left 985555295 5:555155-555177 CCGTGACCTGGCTGGGGCTGCTT No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555293_985555303 20 Left 985555293 5:555153-555175 CCCCGTGACCTGGCTGGGGCTGC No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data
985555290_985555303 25 Left 985555290 5:555148-555170 CCTTGCCCCGTGACCTGGCTGGG No data
Right 985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985555303 Original CRISPR CTTCCTCGCGGGCGCCGGGG CGG Intergenic
No off target data available for this crispr