ID: 985561448

View in Genome Browser
Species Human (GRCh38)
Location 5:588442-588464
Sequence GTATCAGGAGGCTTGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985561448_985561452 18 Left 985561448 5:588442-588464 CCAGCGGCCAAGCCTCCTGATAC No data
Right 985561452 5:588483-588505 ATTGTTTTACATTGTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985561448 Original CRISPR GTATCAGGAGGCTTGGCCGC TGG (reversed) Intergenic
No off target data available for this crispr