ID: 985565133

View in Genome Browser
Species Human (GRCh38)
Location 5:611882-611904
Sequence TCTGGAGGGGTCCCCGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985565124_985565133 -4 Left 985565124 5:611863-611885 CCGGGCGGGTGCTGGGGTGTCTG No data
Right 985565133 5:611882-611904 TCTGGAGGGGTCCCCGCGGGGGG No data
985565115_985565133 30 Left 985565115 5:611829-611851 CCGGGGCTGGACGGGAGGTGCAG No data
Right 985565133 5:611882-611904 TCTGGAGGGGTCCCCGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985565133 Original CRISPR TCTGGAGGGGTCCCCGCGGG GGG Intergenic