ID: 985566395

View in Genome Browser
Species Human (GRCh38)
Location 5:620477-620499
Sequence AGGGCGCAGGGCTGGGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985566382_985566395 20 Left 985566382 5:620434-620456 CCTGTGTCTGCACAGGACAGGGC 0: 1
1: 0
2: 1
3: 24
4: 261
Right 985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG No data
985566380_985566395 21 Left 985566380 5:620433-620455 CCCTGTGTCTGCACAGGACAGGG 0: 1
1: 0
2: 2
3: 74
4: 1386
Right 985566395 5:620477-620499 AGGGCGCAGGGCTGGGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985566395 Original CRISPR AGGGCGCAGGGCTGGGGCCG TGG Intronic
No off target data available for this crispr