ID: 985566913

View in Genome Browser
Species Human (GRCh38)
Location 5:623540-623562
Sequence GAGAAATGTTCTTGGAGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985566913 Original CRISPR GAGAAATGTTCTTGGAGTAC GGG Intronic
902111950 1:14087170-14087192 CAGAAATGTTCTTCGTGTACAGG + Intergenic
903713996 1:25349420-25349442 AATAAATGTTCTTGGGTTACTGG - Intronic
906386586 1:45374718-45374740 GAGATATCTTCATAGAGTACTGG - Intronic
908661467 1:66440238-66440260 TAGAAATGTGTTTGGAGAACTGG + Intergenic
908808999 1:67959969-67959991 GAAAGATGTTTTTGGAGGACTGG + Intergenic
909275794 1:73684841-73684863 GAAAAATTTTCTGGGAGTATTGG + Intergenic
912736420 1:112153135-112153157 GAGAAATGAGCTTGGAATACGGG + Intergenic
913128706 1:115817198-115817220 AAAAAAAGTCCTTGGAGTACAGG + Intergenic
914322763 1:146581119-146581141 GAAAGATGTTCTCGGAGTAAAGG - Intergenic
914426499 1:147582508-147582530 CAGAAATGTTCTTCTAGTACAGG + Intronic
915124792 1:153656381-153656403 CAGAAATGCTCCTGGAGGACAGG - Intergenic
915997814 1:160582078-160582100 GAAAAATGTTCTTGTTGTTCAGG + Intergenic
916811849 1:168312779-168312801 GAGAAATGCTCCTGGGGTGCTGG - Exonic
920974030 1:210768838-210768860 GCTAAATGTTCTCGGGGTACTGG + Intronic
921586373 1:216950796-216950818 GAGAAATGTGCTTTCAGAACAGG - Intronic
1062994637 10:1854413-1854435 GTGCTATGTTCTGGGAGTACAGG + Intergenic
1063884531 10:10563680-10563702 GAGAAATGATCAGCGAGTACAGG - Intergenic
1066411294 10:35171994-35172016 GAGAAGTGGTGGTGGAGTACTGG + Intronic
1070084486 10:73223172-73223194 GAGAAAGGCTTCTGGAGTACTGG - Intronic
1071094118 10:81953105-81953127 GAGAAATGACCTGGCAGTACAGG - Intronic
1071502941 10:86216496-86216518 GAGAAAAGATCTTGGAATATGGG + Intronic
1074232457 10:111551235-111551257 GAGAAATGTACTAGGAATATGGG + Intergenic
1076358877 10:129872835-129872857 GAGAAAGGTTCTTGGATATCAGG - Intronic
1076609657 10:131714802-131714824 GAAAAATGTTATTGGAGTTTTGG + Intergenic
1077650121 11:3963776-3963798 TATAAATGTTGTGGGAGTACAGG + Intronic
1078491841 11:11776740-11776762 GATAGATGTTCTTGGAGCAGAGG - Intergenic
1078829979 11:14969646-14969668 GGGAATTGTTCTTGCAGTACTGG - Intronic
1079548294 11:21662408-21662430 GAAAAATTTTCTTGGAGTATAGG - Intergenic
1080011859 11:27468087-27468109 AAGAAAGGTGCTTGGAGTAGTGG + Intronic
1080587913 11:33698025-33698047 CAGAAAGGTTCTTTGAGGACTGG - Intergenic
1081298982 11:41427201-41427223 GAAAAGTGTTCTTAGAGTTCTGG + Intronic
1083103330 11:60333463-60333485 GAGAAGAGTTCCTAGAGTACAGG + Intergenic
1083288315 11:61675205-61675227 GAGAAAAGTTCTGGCAGTGCAGG + Intergenic
1090675227 11:128986513-128986535 GAGAAATTTTCTGTGAGTACAGG - Exonic
1090976708 11:131685510-131685532 CAGGAATGTGCTTGGCGTACAGG - Intronic
1091294686 11:134465400-134465422 GAGAAATGCTCTAGGAGAACAGG + Intergenic
1091331352 11:134733444-134733466 GAGAAATGTGCTTGGACAAAGGG - Intergenic
1093300393 12:17446216-17446238 GAGAAATATATTTGGAGTCCAGG - Intergenic
1099725782 12:86426219-86426241 CAGCAATGTCCTTAGAGTACTGG + Intronic
1100410132 12:94308796-94308818 GAATGATGTTCTTGGAGAACAGG - Exonic
1103296125 12:119888685-119888707 GAGAAAGGCTCCTGGAGTACAGG + Intergenic
1104820385 12:131673722-131673744 AGGAAATGTTCTTCCAGTACAGG + Intergenic
1106325194 13:28682578-28682600 GTGAAAAGTTCTTGGGGAACAGG - Intergenic
1110291258 13:73809164-73809186 TAGAAAAGTTCTTCAAGTACAGG + Intronic
1112478818 13:99755389-99755411 GTGATCTGTTCTTGGGGTACAGG + Intronic
1113394018 13:109927471-109927493 GATAAATGTTCTCTGTGTACTGG - Intergenic
1117596027 14:57328107-57328129 GAAAAATGTGCATGGAATACAGG - Intergenic
1118780947 14:69007201-69007223 GAGAAATTCTCTTGGAGCCCTGG - Intergenic
1120300896 14:82705371-82705393 AAGAACTCTTGTTGGAGTACTGG + Intergenic
1120506299 14:85356773-85356795 GAGAACTGTTGTTGGAAAACAGG + Intergenic
1122272315 14:100573741-100573763 GGGAAATGGGCTTGGAGTTCAGG + Intronic
1125983009 15:44020654-44020676 GAGAAATATTCTTCCAGTATGGG - Intronic
1130619939 15:85452392-85452414 AAGAACTGTTGTTGGAGAACTGG + Intronic
1131741630 15:95399135-95399157 GATAAATGTTATTGGAGTTGAGG + Intergenic
1133560575 16:6946571-6946593 AAAAAAGGTTCTTGGAGAACAGG - Intronic
1139189854 16:64849559-64849581 GAGAAATATGTTTGGAGTCCTGG - Intergenic
1140010800 16:71129731-71129753 GAAAGATGTTCTCGGAGTAAAGG + Exonic
1140068300 16:71627729-71627751 GAGAAAGGTTCAGGGTGTACTGG + Intronic
1140647128 16:77044728-77044750 AAGAAATGTTCTTGGGGGATAGG + Intergenic
1140789752 16:78380109-78380131 GAGAAGTGTACTTGGGCTACCGG + Intronic
1142809588 17:2389102-2389124 GAGATGTGGTCTTGGAGCACGGG - Intronic
1143131945 17:4684250-4684272 GAGAAATGTGGTAGGATTACTGG - Intronic
1143557204 17:7669327-7669349 AAGAAATGTTCTTGCAGTTAAGG - Exonic
1144052448 17:11508594-11508616 GAGAAATGACCTGGGAGCACTGG - Intronic
1146491960 17:33289964-33289986 CAGAATTGTGCTTGGAGTCCTGG + Intronic
1151060109 17:71081833-71081855 GAGTAATGCTCTTGCAGCACAGG + Intergenic
1153048211 18:876317-876339 GAGAAATTTTCTTGGGTTTCAGG - Intergenic
1153904469 18:9649100-9649122 GAGAAGTGTGCTTGGACTTCAGG + Intergenic
1156698100 18:39792220-39792242 GAGAAAAGTTGATGGAGAACTGG - Intergenic
1156797967 18:41071380-41071402 GGGATGTGTTCTTGGAGTCCAGG - Intergenic
1158079572 18:53573839-53573861 GACAAATGTTTCTGGAGTAGAGG + Intergenic
1160623476 18:80187308-80187330 GAGAAATGTACTTGGAACACTGG + Intronic
1163572275 19:18089678-18089700 AAGAAATATTCTTAGAGTCCAGG + Intronic
1164015944 19:21256086-21256108 GAGATGTGTTATTGGAGAACAGG + Intronic
1165728877 19:38131431-38131453 GTGATGTGTTCCTGGAGTACGGG + Intronic
925223487 2:2161925-2161947 GAGAACCGTTCTTTGAATACTGG + Intronic
928834322 2:35524464-35524486 GAGTAATATTCCAGGAGTACAGG - Intergenic
929933910 2:46279201-46279223 GAGAAATGTTACTCGAGTAAAGG + Intergenic
930216241 2:48700337-48700359 GAGAAATGCTTTTTGAGTAAGGG + Intronic
930683198 2:54279746-54279768 GAGAAATATTCTATGAATACAGG - Intronic
930759583 2:55019246-55019268 GAAAAATGTACGGGGAGTACTGG + Intronic
934512654 2:94958850-94958872 GAGAAATGTCCATGTAGTACTGG + Intergenic
936759838 2:115763764-115763786 GAGAAAAGTTCTTTGAGTTGTGG - Intronic
937242294 2:120470084-120470106 GAGTTATGTGCTTGGAGTTCAGG - Intergenic
943035170 2:182735722-182735744 GAGAAATGTACTTTTCGTACAGG + Intronic
944606861 2:201359654-201359676 CAGCAATGTCCTTGGAGAACTGG + Intergenic
946197811 2:218047229-218047251 GACACATTTTCTTGGAGTATTGG - Intronic
946893887 2:224303338-224303360 GAGAAATGTCCTTAGATTATGGG + Intergenic
1170351678 20:15448163-15448185 GAAAAATGTTCTTGGAATTTTGG - Intronic
1171120174 20:22561790-22561812 GAGAGGTGTTCATGGAGTGCAGG - Intergenic
1173498047 20:43533320-43533342 GTGACATGTTCTTGGATTTCAGG + Exonic
1181560012 22:23694530-23694552 CTGAAAGGTTCTTGGAGTCCAGG + Intronic
1183832538 22:40426035-40426057 GAGAAGTCTTCCTGGAGGACAGG + Intronic
953109400 3:39919140-39919162 GAGAAATGTACCTGGAGTAGGGG + Intronic
953887700 3:46725987-46726009 GAGGAATGATCTTGGAATGCAGG + Intronic
955039189 3:55298315-55298337 AAGAGCTGTTCTGGGAGTACCGG - Intergenic
956433554 3:69211114-69211136 GGGAAATATTCTTGGATCACTGG - Intronic
959688118 3:109169779-109169801 GAGCAATTTTGTTGGCGTACAGG - Intergenic
963226216 3:142864624-142864646 GAGAAATCTTTTTGGAGTGATGG - Intronic
964294218 3:155215838-155215860 GAGGCATGTTCTGGGAGTAATGG + Intergenic
965308736 3:167101502-167101524 GAGAAATGTTTTGCGAGTAGAGG + Intergenic
967088323 3:186113742-186113764 GGGAAGTGTTCTTGCAGTGCTGG - Intronic
967932355 3:194699462-194699484 GAGAAATGGGCTTGGAGAAGAGG + Intergenic
968257553 3:197290682-197290704 GAGCAAAGTTCTGGGATTACAGG - Intronic
968803774 4:2759473-2759495 GACAAGTGTTCTTGGAGGTCTGG - Intergenic
973024710 4:45252691-45252713 ATGAAATGTTCTAGGAGTAAGGG - Intergenic
974297229 4:60016746-60016768 CAAAAATGTTCTTGCAGTATTGG - Intergenic
974945800 4:68527579-68527601 GAGAAATGTTCTTAGGGTACAGG + Intergenic
974955668 4:68638480-68638502 GAGAAATGTTCTTAGGGTACAGG + Intronic
975912976 4:79290628-79290650 GACAACTGTTCCTGGAGTCCTGG - Intronic
978959552 4:114659595-114659617 GAGAAATGTGCATGCAGTGCTGG + Intronic
980449657 4:132954146-132954168 GGAAAATGTTCTAGGAGAACAGG - Intergenic
980589405 4:134865002-134865024 CAAAAATGTTCTTGGAGCAGAGG - Intergenic
980843919 4:138301141-138301163 AAGAAATATTTTTAGAGTACTGG - Intergenic
981935058 4:150230344-150230366 GAGAGAGATTCTTGGGGTACTGG + Intronic
982277066 4:153647009-153647031 CAGAAATTTTCTTGCAGTTCTGG + Intergenic
984490594 4:180430381-180430403 GAGAAATTTTCTCTGAGTTCTGG - Intergenic
985548933 5:523727-523749 GAGAAACGTCCTTGGAGTGATGG - Intronic
985566913 5:623540-623562 GAGAAATGTTCTTGGAGTACGGG + Intronic
986980830 5:13446734-13446756 GAGGAATGATCTTGGAGTCATGG - Intergenic
988310897 5:29556188-29556210 GAGAAATCTTCTTGCAGCTCAGG + Intergenic
990505594 5:56441219-56441241 GTGAAAGGTTCTTGGAGGATGGG - Intergenic
991004209 5:61811925-61811947 GAGGACTGTCCTTGGAGGACAGG + Intergenic
993186283 5:84625449-84625471 GAGAAATGTACTGAGAGCACTGG + Intergenic
996730216 5:126709987-126710009 TACAAATGTTCTGGGATTACAGG + Intergenic
999338991 5:150751442-150751464 GAGAAATCTACTTGGATTTCCGG + Intronic
1000064722 5:157684614-157684636 CAGAAATGTTCTAAGAGTATAGG + Intergenic
1000122599 5:158211502-158211524 TAGAAATGTTCTTGCTTTACTGG + Intergenic
1008947675 6:57116730-57116752 GAGAAATCTGCTAGGAGTAGAGG - Intronic
1009883274 6:69595853-69595875 GAGAAATGTTATTGTTGCACAGG + Intergenic
1010040427 6:71376435-71376457 TAGAATTGTTGTTGGAGGACGGG - Intergenic
1010544660 6:77137561-77137583 GAGAAATCTTCGTGCATTACAGG + Intergenic
1015908583 6:138144115-138144137 GAGGAAGGTTCCTGGAGAACAGG - Intergenic
1017502329 6:155037057-155037079 GAAGAATGTTCTTGAACTACAGG - Intronic
1019088707 6:169505572-169505594 GAGGACTATTCTTGGAGTATAGG - Intronic
1020599781 7:10258713-10258735 GAGAAATGTTAAAGCAGTACTGG + Intergenic
1024522982 7:50323522-50323544 GAGAAGTGTTCTGGGAAAACTGG - Intronic
1025094004 7:56083871-56083893 GAGAAGTGTTCTGGAAGAACTGG + Intronic
1028847653 7:95500241-95500263 GAGAAATGTAGTAGGATTACTGG + Intronic
1030427043 7:109391233-109391255 AAGAAATGTCCTTAGAGTAAAGG - Intergenic
1033936913 7:146597075-146597097 GAAAAATGTTATTGCAGCACGGG + Intronic
1035689551 8:1550930-1550952 GAGACATCTTCATGGAGTAATGG + Intronic
1036108706 8:5874618-5874640 GAGAAATCTTCTTGGAAGGCTGG - Intergenic
1037021162 8:13972708-13972730 GAGAAATGTACTTAGAGAAGGGG - Intergenic
1039273486 8:35908792-35908814 GATAAATGTTCTAGGACAACTGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1040728861 8:50418198-50418220 GAGAAATGTCAGTGGAGTAGTGG - Intronic
1041747069 8:61219275-61219297 GAGAAAGGAACTTGGAGGACAGG - Intronic
1042078324 8:65020478-65020500 GACGAATGTTCTTGGAGTTTTGG - Intergenic
1042775434 8:72425539-72425561 GTGAAATGTTTTTGGAAAACAGG - Intergenic
1043620573 8:82187075-82187097 TAGAAATGTTCATGGTGTATGGG - Intergenic
1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG + Intergenic
1045455453 8:102374479-102374501 GGGAATTGTGTTTGGAGTACAGG - Intronic
1046435046 8:114177071-114177093 CAGAAATGTTCTTCCAGTATAGG + Intergenic
1047668991 8:127124338-127124360 GAGAAATGAGCTGGGAATACAGG - Intergenic
1051730872 9:20141351-20141373 CACAAATGGTCTTGGAGTAAGGG - Intergenic
1053785646 9:41650777-41650799 GAGAAACGCTCTAGGACTACAGG + Intergenic
1054174366 9:61864743-61864765 GAGAAACGCTCTAGGACTACAGG + Intergenic
1054449220 9:65393788-65393810 GAGAAACGCTCTAGGACTACAGG + Intergenic
1054663172 9:67716048-67716070 GAGAAACGCTCTAGGACTACAGG - Intergenic
1055225927 9:73995361-73995383 AAAAAATATTTTTGGAGTACTGG - Intergenic
1059856232 9:118400597-118400619 CAGAAATGTTCTCAGAGTTCTGG - Intergenic
1186716075 X:12253118-12253140 CAGAAATGTTTTTTGAATACTGG + Intronic
1189429498 X:40934344-40934366 GAGAAATATTCCTGGATTCCTGG - Intergenic
1191738803 X:64416011-64416033 AAGAATTCTTCTTGGAGAACTGG + Intergenic
1193626588 X:83829559-83829581 GAGTTAAGTTCTTGGAGAACAGG - Intergenic
1194439503 X:93914032-93914054 GAGAAATGTACTTAGTGTAATGG + Intergenic
1194936033 X:99949989-99950011 GGAAAATGTTCAAGGAGTACAGG - Intergenic
1197066946 X:122245014-122245036 CAGAAAAGTTCTTGAAGGACAGG + Intergenic
1200338368 X:155375893-155375915 GGGAAATGTTCCTGGAGAAATGG - Intergenic
1200348101 X:155464799-155464821 GGGAAATGTTCCTGGAGAAATGG + Intergenic