ID: 985567131

View in Genome Browser
Species Human (GRCh38)
Location 5:624711-624733
Sequence CCTGCCTGGCGGGGACTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985567121_985567131 12 Left 985567121 5:624676-624698 CCAGGGGCGGACACCAGGAGGGA 0: 1
1: 0
2: 0
3: 20
4: 207
Right 985567131 5:624711-624733 CCTGCCTGGCGGGGACTCCGTGG 0: 1
1: 0
2: 1
3: 12
4: 232
985567117_985567131 23 Left 985567117 5:624665-624687 CCGGTCACTCTCCAGGGGCGGAC 0: 1
1: 0
2: 0
3: 8
4: 78
Right 985567131 5:624711-624733 CCTGCCTGGCGGGGACTCCGTGG 0: 1
1: 0
2: 1
3: 12
4: 232
985567125_985567131 -1 Left 985567125 5:624689-624711 CCAGGAGGGAGGAAGGGCAGAGC 0: 1
1: 1
2: 7
3: 92
4: 647
Right 985567131 5:624711-624733 CCTGCCTGGCGGGGACTCCGTGG 0: 1
1: 0
2: 1
3: 12
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985567131 Original CRISPR CCTGCCTGGCGGGGACTCCG TGG Intronic
900074396 1:801401-801423 CCTCCCAGGCGGGGACTCGAGGG - Intergenic
900122605 1:1055248-1055270 GCTTCCCGGCGGGGACACCGTGG - Exonic
900130508 1:1085279-1085301 TCTGCCTGGCAGGGACCCTGCGG + Intronic
900202819 1:1419015-1419037 CCTGCCTGGAGGGGACATCAGGG - Exonic
900587975 1:3442632-3442654 CCTGCCTGGCAGAGCCTCCAAGG + Intergenic
902323496 1:15684081-15684103 CCCGCCTGCCGGGGACCTCGGGG - Intergenic
902331444 1:15732957-15732979 CCTGCCAGGCTGGGAGCCCGAGG + Intronic
903190215 1:21652015-21652037 CCGGCCGGGCGGGGGCTTCGCGG + Intronic
903190231 1:21652055-21652077 CCAGCCGGGCGGGGATTGCGGGG + Intronic
903262901 1:22140967-22140989 CCTTCCTGGCTGGGATTCTGGGG + Intronic
903330585 1:22595130-22595152 CCTGCCTGGCTGTGACCCTGGGG - Intronic
903567047 1:24275480-24275502 CCTGCTTGGTGGGGACTGCAGGG - Intergenic
905183016 1:36178184-36178206 CCTACCTGTAGGGGTCTCCGCGG - Exonic
906179051 1:43802600-43802622 CCAGCCAGGTGGGGACTCCCAGG - Intronic
906686949 1:47769053-47769075 CTTGCCAGGCGGGGACACTGAGG + Intronic
914666972 1:149840424-149840446 CCTGCGTGGCGGGGGGGCCGGGG - Exonic
914668795 1:149853366-149853388 CCTGCGTGGCGGGGGGGCCGGGG + Exonic
915721077 1:157986087-157986109 CCTGCCTGGCAGGTACCACGAGG + Intergenic
917305167 1:173617190-173617212 CCTGCCTTGCTGGGATTCCTGGG - Intronic
917904489 1:179575700-179575722 CCGGACGGGCGGGGACCCCGGGG - Exonic
920280513 1:204839958-204839980 CCTGCCTGGTGGGGAGTGAGTGG + Intronic
922550106 1:226488454-226488476 CCTGCCTGCCCTGGACTCCCTGG + Intergenic
922612234 1:226939459-226939481 GCTGCTCGGCGGGGACGCCGAGG + Exonic
1064302370 10:14134003-14134025 CCAGCCTGGCCGAGACTCAGAGG - Intronic
1067068155 10:43115099-43115121 CCTGCCTGGCCGGGACAAGGAGG - Intronic
1072215124 10:93281389-93281411 CACGCCTGCCTGGGACTCCGGGG + Intergenic
1076031160 10:127159856-127159878 CCTGGGTGGCAGGGACTCCGAGG + Intronic
1076373898 10:129971332-129971354 CGGGCCTGGCGCGGGCTCCGGGG + Intergenic
1076737317 10:132464674-132464696 CCTGCCTGGCCGGGAGGACGGGG - Intergenic
1076765825 10:132632524-132632546 CCTTCCTGGCGGGAATTCTGGGG - Intronic
1076806877 10:132863178-132863200 GCTGCATGCCGGGGCCTCCGTGG - Intronic
1076848564 10:133081967-133081989 ACTGGCTGGCGGGGACACTGTGG + Intronic
1076891185 10:133284284-133284306 CTTTCCTGGCGTGGGCTCCGAGG - Intronic
1076994943 11:293290-293312 CCTGCCTAGTGGGGGCACCGGGG - Intronic
1077051441 11:568648-568670 CCTGCCGGGCGGGGCCTGCGGGG + Intergenic
1077251176 11:1561411-1561433 CCGCCCTGGCGGGGAGTCCAGGG - Intronic
1077265682 11:1648397-1648419 CATCCCTCACGGGGACTCCGCGG - Intergenic
1077360991 11:2139997-2140019 CGCACCTGGCGGGGGCTCCGGGG - Intronic
1077372757 11:2191185-2191207 CCTGCCTGGCGGGAAGGTCGGGG + Intergenic
1080614643 11:33935425-33935447 CCTGCCTCATGGGGCCTCCGAGG - Intergenic
1083304278 11:61754605-61754627 CCTGGCTGGCCTGGACTCCCTGG + Intronic
1083919885 11:65776780-65776802 CCTGCCTGGCGTGAGCTCCCTGG + Exonic
1084003875 11:66313325-66313347 CCTGCCCGACGGCGTCTCCGAGG + Intergenic
1084310353 11:68312958-68312980 CGCGCGTGGCGGGGACGCCGGGG - Intronic
1085176670 11:74493760-74493782 CCTGAGGGGCGGGGACTCGGGGG + Intergenic
1085348077 11:75780912-75780934 CCTGCATGGAGGGAACTCCGGGG + Intronic
1086047094 11:82545966-82545988 TCTGGCTGGCAGGGACTCCAAGG + Intergenic
1086337073 11:85810953-85810975 CCTGCCCGGCAGCGACTCGGAGG - Exonic
1088795723 11:113265394-113265416 ACTGCCTGCTGGGGACTCCAAGG - Intronic
1089308839 11:117544569-117544591 CCAGGCTGGCAGGGACTCCCAGG - Intronic
1089564695 11:119364385-119364407 CCTGCCTGGCCGGGGGTCAGCGG - Intronic
1090387879 11:126367047-126367069 CCTGCCTGTAGGGGGCACCGTGG + Intronic
1091242271 11:134061588-134061610 CCATCCTGGAGGGGACTCTGGGG + Intergenic
1091318964 11:134636297-134636319 CCTGGCTTGCTGGGACTCCCTGG + Intergenic
1091773760 12:3170821-3170843 TCTGCCGGGCAGGGACTCCTGGG + Intronic
1095752548 12:45728766-45728788 TCGGGCGGGCGGGGACTCCGAGG + Intergenic
1098020137 12:66146354-66146376 CCTGCCTGGCTGGGAATTCCTGG + Intronic
1098991071 12:77065488-77065510 CTGGGCTGGCGGGGACCCCGCGG + Exonic
1101042996 12:100776199-100776221 ACTGCCTGGCCTGGACTCCTGGG - Intronic
1103969365 12:124660473-124660495 CCTGCCTGGTGGTAACTCAGAGG + Intergenic
1104747090 12:131217325-131217347 CCGGCCTGGCGGGGCTTGCGTGG + Intergenic
1104847917 12:131856029-131856051 CCTGCCTGGCCTGGGCTCAGGGG - Intergenic
1105514643 13:21078207-21078229 CCGGCCTGGCGGAGGCTCCCCGG - Intergenic
1106568420 13:30906357-30906379 CCCGCCTGGCCGGGACGCGGTGG - Exonic
1107078291 13:36346704-36346726 CGTGCCTGGGGGGGTCTGCGCGG - Exonic
1108323659 13:49309276-49309298 CTTGCCTGGCATGGACCCCGAGG - Exonic
1108498045 13:51044392-51044414 CCTGTCTTGGGGGGACTCCCAGG - Intergenic
1108596732 13:51955946-51955968 CCTGCCTGCCATGGACTCTGGGG + Intronic
1112338514 13:98534144-98534166 GTTCCCTGGTGGGGACTCCGGGG - Intronic
1113809522 13:113129813-113129835 CCTTCCCGGCGAGGACTCAGCGG + Intronic
1121642982 14:95498813-95498835 CCAGCCTGGGGGGGACTGAGAGG - Intergenic
1122471012 14:101965499-101965521 CCTGCCTTGTGGGGACCCAGAGG + Intronic
1122788831 14:104175988-104176010 GCTGACTGGCCGGGACCCCGAGG - Exonic
1122887618 14:104717362-104717384 CCTGCCCGGGGGGGACTGGGAGG - Intronic
1122898521 14:104772433-104772455 CAGGCTTGGCGGGGGCTCCGAGG - Exonic
1202848587 14_GL000225v1_random:1602-1624 CCTGCCAGGCGAGGCCTCTGGGG - Intergenic
1127306104 15:57706969-57706991 GGAGCCTGGCGGAGACTCCGCGG - Intronic
1127429128 15:58884754-58884776 CCTGCCTAGCTGGGACTACAGGG + Intronic
1128154740 15:65385350-65385372 CCCGCCTGGCTCGGACACCGCGG - Intronic
1128521104 15:68375472-68375494 CCTGCCCAGTGGGGACCCCGGGG + Intronic
1128804039 15:70517505-70517527 CCTGCCTGGGGCAGACTCCCTGG - Intergenic
1131063163 15:89416853-89416875 GCTGCCTGGCGGGGACACTCCGG + Intergenic
1131177207 15:90217578-90217600 CCTGCCAGGCGGGGAGTACCAGG + Exonic
1132590343 16:723751-723773 CCTGTCTGGCGGGGGCTTGGTGG + Intronic
1134071803 16:11264922-11264944 CCTGCCTGGAGGGGTCCCAGTGG - Intronic
1134260431 16:12646943-12646965 CGTGCCTGGCAGGGACACTGGGG - Intergenic
1134291152 16:12903334-12903356 CCTGGCTGGCGTGGACTCCGGGG + Intronic
1136170098 16:28484001-28484023 CCTACCTGGCTTCGACTCCGGGG + Exonic
1141698861 16:85633295-85633317 CCTGAGTGGCGGGGAGGCCGGGG + Intronic
1141707608 16:85676526-85676548 CCTGCCTGGCGGGGACACGTGGG + Exonic
1142032652 16:87846261-87846283 CCTGCCTGTGGGGGACTCCAGGG - Intronic
1142070964 16:88091067-88091089 CTTGCCTGGCGGGGACAGCCAGG + Intronic
1142271330 16:89091180-89091202 CCTGCCAGGCCAGGACTCCCGGG + Intronic
1142416584 16:89946711-89946733 CCTGCCTGGCTGAGCCTCTGTGG - Intergenic
1142549942 17:732407-732429 CCCGCCCGCCGGGGACGCCGGGG + Exonic
1142684800 17:1571626-1571648 CTTGCCTGCCGTGCACTCCGAGG - Intronic
1143561959 17:7701752-7701774 CCGGCCTGGCCGAGACTGCGAGG + Exonic
1144252248 17:13429323-13429345 CCTGCCTGGCCAGGGCTGCGAGG + Intergenic
1144787435 17:17839869-17839891 CCTGCCCGCCGGGGTCACCGTGG - Intergenic
1146970463 17:37067758-37067780 CATGGCTGGCGGTGACTCTGTGG + Intergenic
1147322300 17:39653576-39653598 CCTGCCTGCCGTGGCCTCCCTGG + Exonic
1148733537 17:49851817-49851839 ACTGCCTGGTGGGGACCCTGGGG + Intergenic
1150726294 17:67653996-67654018 CCTGCTTGGCTGGGACCACGAGG + Intronic
1152630871 17:81410218-81410240 CTTCCCTGGCGGAGACTCAGAGG + Intronic
1160894776 19:1397295-1397317 CCTTCCTGGCCGGGAGTCCAGGG - Intronic
1161390600 19:4018524-4018546 TCTGCCTGGCAGGGCCCCCGTGG + Intronic
1161457296 19:4375811-4375833 CCTGCCAGGCGGAGCCTCAGGGG - Intronic
1162020064 19:7864264-7864286 CCTGCCTGGCGCAGGCACCGTGG + Intronic
1162621709 19:11848995-11849017 CCTCCCTGTGGGCGACTCCGGGG + Intronic
1162630773 19:11925355-11925377 CCTCCCTGTGGGCGACTCCGGGG + Intronic
1162672102 19:12266179-12266201 CCTCCCTGCGGGCGACTCCGGGG - Intronic
1162746608 19:12802067-12802089 CCAGCATGGCGCGGACCCCGGGG + Intronic
1162792330 19:13069543-13069565 CCTGCCTGGCAGGGACTGCCAGG + Intronic
1163831804 19:19550601-19550623 GCTGCCTGGCGGGGCCTCTGAGG + Intergenic
1165087517 19:33361366-33361388 CCGGCCTGGAGGGGACTTCCAGG + Intergenic
1166068097 19:40371863-40371885 CCTACCTGGCGGTGAGTCTGGGG + Exonic
1166856132 19:45783392-45783414 CCTGCCCAGCTGGGACTCCTCGG - Exonic
1167079889 19:47271480-47271502 CCGGACTGAAGGGGACTCCGTGG - Exonic
1167611533 19:50510208-50510230 CCTGCCTGGCGGCGAGACCCAGG + Intronic
925024268 2:595302-595324 CCTGCCTGGCCGGGGGTCCTTGG + Intergenic
925169102 2:1740197-1740219 CCCGCCTGCCGGGGACTCCCTGG - Intronic
925294396 2:2767895-2767917 CCTGCCTGGCCAGGTCTCCCGGG + Intergenic
925464666 2:4096188-4096210 GCTGCCTGCGGGGGACTCAGGGG + Intergenic
927889987 2:26742239-26742261 CCTGCCTGGCAGGGAGGCCAAGG + Intergenic
929950397 2:46405657-46405679 CCTGCGTGGCTGGGGCTCCTTGG - Intergenic
932607693 2:73175914-73175936 CCTGCCCGGCAGTGACTCGGTGG + Intergenic
936094924 2:109524082-109524104 CCAGCCTCACTGGGACTCCGTGG + Intergenic
936959012 2:118053873-118053895 CCTGCCTGGGAGGGGCTCCATGG + Intergenic
937247328 2:120502077-120502099 CCTGCCTGGCGGGGAGCAGGTGG - Intergenic
940174183 2:150860611-150860633 CCTGCCTTGCTGGGAATCCAGGG - Intergenic
941147780 2:161873851-161873873 GGTGCCTGGCGGAGTCTCCGTGG + Intronic
947212136 2:227718047-227718069 CCTGCCTGGCCCGGAGCCCGGGG + Intergenic
948454233 2:238097336-238097358 GCTGCCTGGCGGAGACTGTGGGG + Intronic
948806630 2:240455979-240456001 CCAGCCTGCCGGGGGCTCCCAGG + Intronic
1171231542 20:23491065-23491087 CCTGCAGGGCGTGGACTCAGAGG + Intergenic
1171417518 20:24992945-24992967 CCCGCCTGTCTCGGACTCCGGGG + Exonic
1171487616 20:25495660-25495682 CATGCCTGGAGGGTCCTCCGGGG - Intronic
1174287812 20:49484375-49484397 CCAGCCTGCCGGGGAGGCCGGGG + Intergenic
1174376377 20:50129181-50129203 CCTGCCTGGCAGGGCTTCTGGGG - Intronic
1175157069 20:56978318-56978340 CCAGCCTTGCGGGGAAGCCGTGG + Intergenic
1175517215 20:59577383-59577405 TCCGCCGGGCGGGGGCTCCGAGG - Intergenic
1175883521 20:62274326-62274348 GCAGCCTGGCTGGGGCTCCGGGG + Intronic
1176145712 20:63564546-63564568 CCTGCCTGGCCGGGACCGCCTGG - Exonic
1176182029 20:63754122-63754144 CGTGCCAGGCGGGGCCTCCGGGG - Intronic
1176522885 21:7838146-7838168 CCTGCCTTGCTGGGATTCCTTGG - Intergenic
1178656905 21:34468158-34468180 CCTGCCTTGCTGGGATTCCTTGG - Intergenic
1179605788 21:42514305-42514327 CGCCCCTGCCGGGGACTCCGTGG - Exonic
1179805621 21:43835306-43835328 CGGGCCTGGCTGTGACTCCGGGG + Intergenic
1180980161 22:19874570-19874592 CCAGCCTGGCGGTGCCTCCACGG + Intergenic
1181513767 22:23400372-23400394 CCGGCAGGGCGGGGACTACGTGG - Intergenic
1181941867 22:26483922-26483944 CCTGGCAGGCGGCGGCTCCGCGG + Exonic
1181974729 22:26720867-26720889 CCTGCCTGCCAGGGTCTCTGAGG - Intergenic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1183493377 22:38128341-38128363 CCTGCTCCGCGGGGACCCCGTGG + Exonic
1183675539 22:39297113-39297135 CCTGCCTGGCGGGCTCCCAGCGG - Intergenic
1183961531 22:41414265-41414287 CCTTCCTGGCCTGGACTCTGGGG + Intergenic
1184288742 22:43486968-43486990 CCTGACTGTCAGGGACTCTGAGG + Intronic
1184824818 22:46942655-46942677 CCGGCTTGGAGGGGCCTCCGTGG - Intronic
1184962934 22:47944694-47944716 GCTGCCTGGAGGGGACACTGTGG - Intergenic
1185012239 22:48320784-48320806 CCAGCCTGCCTGGGACTCCCAGG + Intergenic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
1185269628 22:49923056-49923078 CCTGCCGCGTGGGGCCTCCGAGG + Intronic
949414667 3:3800961-3800983 CTTGCCAGGCAGGGACTCCCTGG - Intronic
953404681 3:42654545-42654567 CCTGCCTGGCCGCGCCCCCGGGG + Intronic
956745889 3:72310828-72310850 CCTGCCTTGCAGGCACTCTGGGG - Intergenic
960055540 3:113274145-113274167 CCTGCCTGGCCAGGGCTCAGGGG - Intronic
961314044 3:126022439-126022461 TCTTGCTGGCGGGGACTCTGTGG + Intronic
968027187 3:195452268-195452290 TCTTGCTGGTGGGGACTCCGTGG + Intergenic
968448702 4:665129-665151 CCTGTGTGGTGGGGACCCCGGGG + Intronic
968481188 4:833752-833774 CCTGCCTGGCTGGAACACAGTGG - Intergenic
968683920 4:1943363-1943385 GGTGCCTGGCCAGGACTCCGTGG + Intronic
968944929 4:3658637-3658659 CCAGCCTGGCAGGGAGCCCGGGG - Intergenic
969115293 4:4867336-4867358 CCGGCCTGGCCGGGCCCCCGAGG + Intergenic
969424145 4:7114120-7114142 CCTGCCTTGTGGGGATTCCTCGG - Intergenic
969475556 4:7420717-7420739 CATACCTGGAGAGGACTCCGTGG + Intronic
969559701 4:7939400-7939422 TCTGCCCGGAGGGGACTGCGTGG - Exonic
969912916 4:10461623-10461645 CCAGGCTGGCGTGGAATCCGAGG + Intergenic
975683623 4:76898389-76898411 CCTGCGTGGCGGAGACTTAGAGG - Intergenic
981205140 4:142032234-142032256 TCTGCCTGGCTGGGTCTCAGTGG + Intronic
981534142 4:145782048-145782070 CCTGCCTCACTGCGACTCCGGGG - Intronic
982198490 4:152937630-152937652 CCTGCGGGGCGGGGACTGCGGGG - Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
984462861 4:180058676-180058698 CCGGGCGGGCGGGGACGCCGGGG - Intergenic
985567131 5:624711-624733 CCTGCCTGGCGGGGACTCCGTGG + Intronic
985716218 5:1463404-1463426 CCCGCCTGGCCTGGACCCCGTGG - Exonic
985878424 5:2618882-2618904 CCTGCCTGGCGCCTCCTCCGTGG + Intergenic
990312604 5:54554016-54554038 TCTGCATGGCTGGGCCTCCGTGG + Intergenic
991491006 5:67182533-67182555 CCTCCCTGTGGGAGACTCCGGGG + Exonic
992396331 5:76372494-76372516 CTTGCCTGGCAGGGGCTCCCAGG - Intergenic
994171401 5:96662602-96662624 CCTGCCCCGCGGGGGCGCCGGGG - Intronic
995955679 5:117773533-117773555 CCTGCCTGGTGGGGACACGTGGG - Intergenic
997439479 5:133899110-133899132 CCTGCCTGGCTAGGACTGCAGGG + Intergenic
997990802 5:138543130-138543152 CCTCCCCGGCGGCGGCTCCGCGG + Exonic
999262031 5:150244397-150244419 CCTGCCTGGCGAGGGCCCCAGGG - Intronic
999966833 5:156819181-156819203 TCTGCCTGGCAGGGACTAGGTGG + Intergenic
1000343280 5:160294174-160294196 CCTGCCTTGCTGGGCCTCCCAGG - Intronic
1001441970 5:171750320-171750342 CCTGCCTGGAGGGGATGCCCAGG - Intergenic
1002189838 5:177472739-177472761 CCTACCTGAAGGGGACTGCGGGG - Intronic
1002199171 5:177517397-177517419 CATCCCTGCCGGGGACGCCGGGG + Exonic
1002296254 5:178232831-178232853 CCTGCGGGGCGGGGCCTGCGGGG - Intergenic
1002643234 5:180640460-180640482 CCTGCCTGCAGGGGTCTCTGAGG - Intronic
1003349543 6:5303192-5303214 CTTCCCTGGCAGGGACTCAGTGG + Intronic
1003624061 6:7726942-7726964 CCGGCCGGGCGGGGATGCCGGGG + Exonic
1006169980 6:32087110-32087132 CCTACCTGGCCGGGGCTCCAGGG - Intronic
1007071410 6:39040947-39040969 CTTACCTGGGGGGGACTCTGAGG + Intergenic
1007248124 6:40476905-40476927 CCTGCCTGGGCTGGACTCCAAGG + Intronic
1011182366 6:84635333-84635355 CCTGCCTTGTGGGGACTACCGGG - Intergenic
1012530412 6:100229068-100229090 CCTGCCTGGCTGGGCCGCCAGGG - Intergenic
1016936325 6:149451354-149451376 CCGGCCTGGCGCGGGCGCCGAGG - Exonic
1017103386 6:150866716-150866738 CCAGCTGCGCGGGGACTCCGTGG - Intronic
1018650708 6:165989090-165989112 CCCGGCTCGCGGGGAATCCGTGG + Intergenic
1019391045 7:787093-787115 TCAGCCTGGGGGGGACGCCGGGG + Intergenic
1019450748 7:1096471-1096493 CAGGCCGGGCAGGGACTCCGTGG + Intronic
1019516455 7:1442295-1442317 CCTGCCTGCCGGGGGCAACGCGG + Exonic
1019666162 7:2253177-2253199 CTTTCCTGGCAGGGACTCCGGGG - Exonic
1022207555 7:28179668-28179690 CCGGCCTGGCGCGGACGCCCGGG - Intronic
1025190080 7:56889603-56889625 ACTGCCTGGAGGGGACTCTCAGG - Intergenic
1025681860 7:63687318-63687340 ACTGCCTGGAGGGGACTCTCAGG + Intergenic
1026938918 7:74275457-74275479 CCTGCCTGCAGGGGACACTGTGG + Intergenic
1029525066 7:101089100-101089122 ACTGCCTAGCGGGGACCGCGTGG + Exonic
1030527856 7:110674949-110674971 ACTGGCTGGGAGGGACTCCGTGG - Intronic
1031966830 7:128032701-128032723 ACTGCGTGGTGGGGACTCGGGGG + Intronic
1032007077 7:128311160-128311182 CCTGTCTGCTGGGGACTCAGGGG + Intronic
1032071055 7:128807279-128807301 CCTCCCAGGCGGGGACTAAGGGG - Intronic
1035541246 8:440078-440100 CCTCCCAGGCGGGGACTCGAGGG + Intronic
1035577545 8:717382-717404 CCTGCCCGGCGGAGACACCTTGG + Intronic
1036752054 8:11449635-11449657 CCTGCCTGGCGGGGCGTGCCTGG - Intronic
1036993441 8:13627088-13627110 CCTTCCTGGGTGGGACTCAGGGG - Intergenic
1038424349 8:27454714-27454736 CCCACCTGGTGGGGACTCAGTGG - Intronic
1047998251 8:130357335-130357357 CCTGCCCGCAGGGCACTCCGAGG - Intronic
1048993528 8:139775118-139775140 CCTGACTGGGCGGGACTCTGGGG + Intronic
1048997541 8:139803725-139803747 CCTGCCTTCCAGTGACTCCGGGG - Intronic
1049580258 8:143407766-143407788 CCCGTCTGGCCGGGACCCCGTGG - Intergenic
1049800946 8:144517331-144517353 GCGGCCTGGCCGCGACTCCGTGG + Intronic
1057314186 9:93958449-93958471 CCTCCCTGTCGAGGACACCGAGG + Intergenic
1058572182 9:106358774-106358796 ACAGCCTGGCAGGGACTCCAAGG + Intergenic
1059391277 9:114001107-114001129 CCAGCCTGGCAGGGACCCCAGGG - Intronic
1061201422 9:129140606-129140628 CCTGCCCGGCAAGGGCTCCGAGG - Intronic
1061907622 9:133706934-133706956 CCTGCCTGCCTGGGATTCTGAGG + Intronic
1062387543 9:136318972-136318994 TCTGCCTTGCTGGGCCTCCGAGG - Intergenic
1062427339 9:136512035-136512057 CCTGCCTGCCCGGGTCACCGTGG - Intronic
1062621324 9:137423673-137423695 CCTGCTGGCCGGGGACCCCGAGG + Exonic
1203781259 EBV:102071-102093 CCTGCCTCGAGAAGACTCCGGGG - Intergenic
1187826106 X:23334543-23334565 CCCCCCTGGCGGGGAGGCCGCGG + Exonic
1189473575 X:41333032-41333054 CCGGCGTTGCGGGGACCCCGCGG - Intergenic
1192292718 X:69814970-69814992 CCTGCCTTGCTGGGAATCCCAGG - Intronic