ID: 985571127

View in Genome Browser
Species Human (GRCh38)
Location 5:645889-645911
Sequence CGTCCACACAGGCCGCCGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571127_985571132 27 Left 985571127 5:645889-645911 CCCGTCGGCGGCCTGTGTGGACG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571127 Original CRISPR CGTCCACACAGGCCGCCGAC GGG (reversed) Intronic
900309766 1:2028064-2028086 CGTCCACACAGGAAGCCTGCAGG - Intronic
901642956 1:10702310-10702332 GGTCCACAGAGGCCTCCCACTGG + Intronic
903525173 1:23987773-23987795 CTTCCTAACAGGCCGCAGACTGG + Intergenic
916037414 1:160933550-160933572 CTTCCACACAGGGCGGCGGCTGG - Intergenic
922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG + Intergenic
923505720 1:234604874-234604896 CGTCCACAAAGGCCACCCAAAGG + Exonic
924775378 1:247112027-247112049 AGTCCACGCGGGCCGCCGAGAGG - Exonic
1062768554 10:82875-82897 CGTCCCCATAGGCCTCTGACTGG - Intergenic
1063072595 10:2680954-2680976 CGTCCACACAGGCAGCTGCAAGG + Intergenic
1066452887 10:35547689-35547711 CATCCACACAGGGCTCCGGCAGG - Intronic
1070282885 10:75062647-75062669 GGTGCACACAGGCCGCCTTCAGG - Intergenic
1071568699 10:86684801-86684823 CTCCCTCACAGGCCCCCGACAGG + Intronic
1076839615 10:133039575-133039597 CGTCCACACGGGCTGGCGAGGGG - Intergenic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1077102883 11:829982-830004 CGTCCTCACAGCCCGCTGCCTGG - Exonic
1077350559 11:2091284-2091306 CAGCCCCACAGGCCTCCGACCGG - Intergenic
1077543067 11:3156774-3156796 CTTCCACACAGGCCGAGGGCCGG + Intronic
1083741235 11:64712704-64712726 TGACCACACAGGCTGCCCACAGG + Intronic
1089398004 11:118148395-118148417 GGTCCACAAAGGCCGCCGGAGGG + Intronic
1101964203 12:109271221-109271243 CATCCACACAGGCCACAGAAAGG + Intergenic
1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG + Intergenic
1112567263 13:100562201-100562223 GGTCCACACAGGCAGTGGACAGG - Intronic
1113650307 13:112029619-112029641 CCTCGACACAGGCTGCTGACTGG + Intergenic
1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG + Intergenic
1132484130 16:181394-181416 CGTCCTCGCAGCCCGCCGCCCGG - Intergenic
1142157320 16:88538496-88538518 CGTCGGGACAGGCCGCCAACGGG - Intergenic
1152551331 17:81031900-81031922 CATGCACACAGGGCGCCGAGCGG - Intergenic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG + Intergenic
933973106 2:87486153-87486175 CGCCCACAGAGGCCGGCGTCTGG + Intergenic
936320614 2:111464060-111464082 CGCCCACAGAGGCCGGCGTCTGG - Intergenic
942461599 2:176172118-176172140 AGTCCACGCTGGCCGACGACGGG - Exonic
1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG + Intronic
1175940891 20:62537054-62537076 CCTCCACACAGGCCTCCTCCTGG - Intergenic
1176187993 20:63791985-63792007 CCTCCACACAGAACGCCGGCTGG - Intronic
1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG + Exonic
953326740 3:42017909-42017931 AGTCCAAACAGGCTGCCTACAGG - Intronic
960165308 3:114394770-114394792 AGTTCACACAGCCAGCCGACTGG + Intronic
961545502 3:127629987-127630009 CACCCACACAGCCCGCCGCCCGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571135 5:645954-645976 CATCCACACAGGGCGCCAACGGG - Intronic
985571147 5:646019-646041 TGTCCACACAGGCCGCCGATGGG - Intronic
985571154 5:646084-646106 CATCCACACAGGCCGCCAATGGG - Intronic
994355840 5:98793153-98793175 CATCCACAAAGGCGGCCGGCAGG - Exonic
1002175738 5:177400139-177400161 CGGCCAGCCAGGCCGCCCACTGG - Exonic
1006804141 6:36777504-36777526 CGTCCACACAGGCCCCCTCCAGG - Intronic
1006845193 6:37056695-37056717 TTCCCACACAGGCAGCCGACAGG - Intergenic
1016739091 6:147509195-147509217 CGTCCCCACCGGCCGCCGGGGGG + Exonic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1046990349 8:120445515-120445537 CCTCCCTACTGGCCGCCGACGGG - Exonic
1048993819 8:139776632-139776654 CGTGCACACAGGCAGATGACGGG - Intronic
1057361086 9:94374497-94374519 CCTCCCCACAGGCCGGCGCCGGG - Intergenic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1062497161 9:136837384-136837406 CGTCCCCACTGGCGGCCAACGGG + Exonic
1203793730 EBV:165072-165094 CGGCCACACAGGAGGCCAACAGG - Intergenic
1202101310 Y:21310483-21310505 CTTCCTAACAGGCCGCGGACAGG + Intergenic