ID: 985571128

View in Genome Browser
Species Human (GRCh38)
Location 5:645890-645912
Sequence CCGTCCACACAGGCCGCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571128_985571132 26 Left 985571128 5:645890-645912 CCGTCGGCGGCCTGTGTGGACGG No data
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571128 Original CRISPR CCGTCCACACAGGCCGCCGA CGG (reversed) Intronic