ID: 985571128

View in Genome Browser
Species Human (GRCh38)
Location 5:645890-645912
Sequence CCGTCCACACAGGCCGCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571128_985571132 26 Left 985571128 5:645890-645912 CCGTCGGCGGCCTGTGTGGACGG 0: 1
1: 1
2: 1
3: 6
4: 55
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571128 Original CRISPR CCGTCCACACAGGCCGCCGA CGG (reversed) Intronic
900350476 1:2232095-2232117 CCGCCCTCACTGGCCGCCGTTGG + Intronic
901019483 1:6248641-6248663 ACCTCCACAAAGGCCGCAGAGGG + Exonic
903552810 1:24169716-24169738 CCGTCCAGACAGGCAGCCACTGG + Intronic
915141762 1:153772453-153772475 CCGTCTACACTGGACGCCGAGGG - Intronic
1065101360 10:22335629-22335651 CCGTCCACCCGGAGCGCCGAGGG - Intergenic
1069642320 10:69963881-69963903 CTGTCCACACTGGCCACCGCAGG - Intronic
1070257764 10:74825978-74826000 CCGTCCGCACACTCCACCGAAGG + Intronic
1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG + Intergenic
1076839616 10:133039576-133039598 GCGTCCACACGGGCTGGCGAGGG - Intergenic
1077006676 11:361231-361253 CCTTCCACACAGGCCAAAGAAGG - Intergenic
1077059526 11:611751-611773 CCGCCCACGCAGGGGGCCGAGGG + Exonic
1077198194 11:1291845-1291867 CCGTCCTCACCGACCCCCGAGGG + Intronic
1083221083 11:61253061-61253083 CCGTCCACCCTGGCCTCCCACGG + Intergenic
1089398003 11:118148394-118148416 TGGTCCACAAAGGCCGCCGGAGG + Intronic
1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG + Intergenic
1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG + Intergenic
1121765341 14:96481033-96481055 CCTACCACACAGGCCACAGAGGG - Intronic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1128046126 15:64618963-64618985 CCGTGGACACAGGCCCCTGATGG + Intronic
1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG + Intronic
1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG + Intronic
1136020332 16:27436119-27436141 TCGCCCACACAGGTCGCCCATGG + Intronic
1137712418 16:50575524-50575546 CCGTCCCCACAGCCCGGGGAAGG - Intronic
1142157321 16:88538497-88538519 CCGTCGGGACAGGCCGCCAACGG - Intergenic
1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG + Intronic
1142202069 16:88765915-88765937 CCGCCCACCCAGGCCTCCCAAGG + Intronic
1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG + Intronic
1151930772 17:77230236-77230258 CCGTCCCCACAGGCCGGCCCGGG - Intergenic
1161991380 19:7686176-7686198 CCATCCCCACCGGCCACCGAGGG + Exonic
1163813129 19:19447163-19447185 CCCTCCACACATGCCCCCCAGGG - Intronic
1164562334 19:29300801-29300823 CAGGCCACACAGGCAGCCGGCGG - Intergenic
1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG + Intergenic
1168435076 19:56310229-56310251 CCCTCCACACAGGCAGTCCAGGG - Intronic
947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG + Intronic
947752521 2:232540308-232540330 CAGTCCCCACAGGCCACCAATGG - Intronic
1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG + Intergenic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG + Intronic
969100492 4:4764705-4764727 CCGTCCACCCAGGGCACCGCCGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571136 5:645955-645977 CCATCCACACAGGGCGCCAACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
997625246 5:135326915-135326937 CCGTCCACAGAGGCTGGCCAGGG + Intronic
1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG + Intergenic
1011517355 6:88167344-88167366 CCGTGCACACAGGAGGCAGACGG - Intergenic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1019828327 7:3301605-3301627 CCGCCGCCACCGGCCGCCGAGGG - Exonic
1020014867 7:4825044-4825066 CCGTCCACACAGGCCTGGGTAGG - Intronic
1020085883 7:5310025-5310047 CCATCAACTCAGGCGGCCGAGGG - Intronic
1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG + Intronic
1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG + Exonic
1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG + Intergenic
1025663529 7:63569753-63569775 CCATCAACTCAGGCGGCCGAGGG - Intergenic
1026895911 7:74010035-74010057 CCGTCCACACAGGCTGTCTGTGG - Intergenic
1035223576 7:157421022-157421044 CCGTCCACAGAGGCAGCCTTGGG - Intergenic
1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG + Intergenic
1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG + Intronic
1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG + Intergenic
1061225946 9:129281051-129281073 CTGTCCACACAGGCCCCAGCTGG - Intergenic
1062166936 9:135112633-135112655 CCGTCCACCCAGTCCGCACAGGG + Intronic
1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG + Intergenic
1062353237 9:136149226-136149248 CCGTCCCCACAGGCAGCCCCAGG + Intergenic
1186553429 X:10531423-10531445 CTGGCAAGACAGGCCGCCGAGGG + Intronic