ID: 985571132

View in Genome Browser
Species Human (GRCh38)
Location 5:645939-645961
Sequence AGCGTCACTCCTGCTCCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 2, 1: 0, 2: 2, 3: 2, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571127_985571132 27 Left 985571127 5:645889-645911 CCCGTCGGCGGCCTGTGTGGACG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71
985571128_985571132 26 Left 985571128 5:645890-645912 CCGTCGGCGGCCTGTGTGGACGG 0: 1
1: 1
2: 1
3: 6
4: 55
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71
985571131_985571132 16 Left 985571131 5:645900-645922 CCTGTGTGGACGGTGAATTCGGC 0: 1
1: 3
2: 1
3: 0
4: 28
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571132 Original CRISPR AGCGTCACTCCTGCTCCCGT TGG Intronic
900922605 1:5683099-5683121 AGCGTCACTGCTGCTGCTGATGG - Intergenic
1063376318 10:5556683-5556705 AGCTTCACTCCTGAGCCCCTGGG - Intergenic
1066541007 10:36446948-36446970 AGCGTCACCTCTGCTCGCCTGGG - Intergenic
1071168768 10:82838007-82838029 AGCATCACTCCTGCTCCTCCTGG - Intronic
1071347666 10:84707854-84707876 ATCACCACTCCTGCTCCCATTGG - Intergenic
1072753585 10:98001939-98001961 AGCATCACTGCTGCTCCAGGGGG - Intronic
1075207157 10:120457508-120457530 AGGGTCTCTCTTGGTCCCGTAGG - Intronic
1076058508 10:127394927-127394949 GGCATCACTCCTGCACCTGTGGG - Intronic
1078445628 11:11403016-11403038 AGCGTCATTCCTTCTGCCCTGGG - Intronic
1083694737 11:64435142-64435164 AGTCTCACACGTGCTCCCGTCGG - Intergenic
1089748882 11:120636296-120636318 AGGGGCACTCATGCTCCCCTGGG - Intronic
1091699975 12:2652814-2652836 AGCGGCAGTCCTGCTTCCGCTGG - Intronic
1097032866 12:56102049-56102071 AACGTAACTCCTGCTCCCTGTGG + Exonic
1101850944 12:108401817-108401839 AGTGTCACTCCTCCTCCCAGGGG - Intergenic
1104012721 12:124943373-124943395 AGCCTAACTCCTGCTCCCTCTGG - Intergenic
1118004891 14:61556610-61556632 TGCGTAACCCCTGCTCCCCTTGG + Intronic
1120765331 14:88323188-88323210 AGTGTCACTCCAGCCCCCGAAGG + Exonic
1127060159 15:55174230-55174252 AGCGTCACTCTTGCCCAGGTTGG - Intergenic
1129696587 15:77743714-77743736 AGCATCCCTCCTGCGCCCCTGGG - Intronic
1129978435 15:79844248-79844270 AGTGTCACACCTGCTTCCCTTGG - Intronic
1131642483 15:94307427-94307449 AGGGACACTCCTGCTACCCTGGG - Intronic
1133293281 16:4736680-4736702 AGCGTCATGCCTGCTCTGGTAGG - Intronic
1133764664 16:8829571-8829593 AGGCTCACACTTGCTCCCGTTGG + Intronic
1141496142 16:84411012-84411034 AGAGTCACTCCTGCTACCTGTGG - Intronic
1143144127 17:4762639-4762661 AGCGGCACTCCTGCTCTTCTAGG + Intergenic
1146789994 17:35745738-35745760 ACCGCCCCTCCTGCTCCTGTAGG + Exonic
1151408265 17:73903261-73903283 AGCGTCTCGCCTGATTCCGTAGG - Intergenic
1152500436 17:80705015-80705037 AGCGTGTCACCTGCTCCCATAGG - Intronic
1155207664 18:23575123-23575145 CTTGTCACTCCTGCTCCTGTGGG - Intronic
1157702123 18:49768044-49768066 TGCGTCCCACCTGCTACCGTAGG + Intergenic
1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG + Exonic
1166988252 19:46675158-46675180 AGGGTCACTCCTCCTCCAATAGG + Intronic
927053725 2:19352070-19352092 ACCGTCCCTGCTGCTCCCCTAGG - Exonic
936261415 2:110962551-110962573 AGCATCAGTCCTGCTCCTGTGGG - Intronic
940100289 2:150029703-150029725 TGGGACACTCCTGCTCCCTTTGG - Intergenic
946114198 2:217447254-217447276 AGCATCTCTCCTTCTCCCCTTGG - Intronic
947268533 2:228307682-228307704 AGGGTCACGCCTGCAGCCGTGGG - Intergenic
1171462532 20:25307032-25307054 AATGTCACCCCTGCTCCCTTAGG - Intronic
1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG + Intergenic
1178453716 21:32728002-32728024 AGCGTCACTTCCGCTCCAGCAGG + Exonic
1181267794 22:21641353-21641375 AGCTTCACTCCAGATCCTGTGGG - Intergenic
1181468838 22:23125752-23125774 AGCGTCTCTGCTCCTCCAGTGGG - Intronic
1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG + Intronic
949697250 3:6713280-6713302 AGAGTTACTCCTGTTCCTGTTGG + Intergenic
960987852 3:123292244-123292266 AGAGTCAGTCCTGGTCCTGTTGG - Intronic
962067430 3:131996559-131996581 ACCGTCACTGCTGCTCCGCTAGG - Intronic
967828951 3:193902469-193902491 AGCCTCCCTCCTGCTCCTGCTGG + Intergenic
969323488 4:6427096-6427118 AGTGTCACACTTGCTCCCCTTGG - Intronic
971312439 4:25537022-25537044 AAAGTCACTCCTTCTCCCATGGG + Intergenic
972773164 4:42217429-42217451 TGTGTCACTCCTGACCCCGTGGG - Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG + Intronic
985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG + Intronic
993020437 5:82584831-82584853 AGCATCACTGCAGCTCCAGTTGG - Intergenic
999286435 5:150396888-150396910 AGGGTCCCTCCCGCCCCCGTGGG - Intronic
1001708626 5:173760318-173760340 AGCCCAACTCCTCCTCCCGTGGG + Intergenic
1002705626 5:181159683-181159705 AGCCTCCCTCCTGCTGCCCTTGG + Intergenic
1003257396 6:4486488-4486510 TACGTCACTGCTGCTCCCGGAGG + Intergenic
1004479695 6:16006802-16006824 AGCTTCACTCATGCTCACCTTGG + Intergenic
1006651326 6:35554213-35554235 AGCCAAACTCCTGCACCCGTTGG - Intergenic
1013298316 6:108780182-108780204 AGCCCCACTCTTGCTCTCGTGGG - Intergenic
1015539269 6:134297890-134297912 AGCCTCACTCCGGCTGCGGTTGG + Intronic
1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG + Intergenic
1018624489 6:165764680-165764702 AGCTTCACTCCTGAGCCGGTGGG - Intronic
1018802966 6:167237644-167237666 AGAGTCACAGCAGCTCCCGTGGG + Intergenic
1019664329 7:2243888-2243910 AGGGTCCTTCCTGCTCCCATAGG - Intronic
1020084135 7:5301581-5301603 AGCATCCCTCCAGCTGCCGTGGG + Intronic
1022521820 7:31013391-31013413 AGCCTCACTCCTGCTTTCGGAGG + Intergenic
1026902588 7:74045260-74045282 GGCTTAACTCCTGCTCCAGTGGG - Exonic
1034501020 7:151451243-151451265 AGCTTCACTCCTGCTCCCTGTGG - Intergenic
1035889956 8:3332442-3332464 AGCCTCACTGCAGCTCCGGTTGG - Intronic
1052019804 9:23512588-23512610 AGGCCCACTCCTGCTCCCTTTGG - Intergenic
1057725463 9:97565016-97565038 AGCGTCACTTTAGCTCCCATGGG - Intronic
1061091430 9:128428659-128428681 AGCCTCATTCCTGCCCCCTTTGG - Intronic
1189968922 X:46398461-46398483 AATGTCACTCCTGCCCCCTTAGG + Intergenic
1190296312 X:49029860-49029882 AGCCTCACCCCTGCCCCTGTGGG - Exonic