ID: 985571132

View in Genome Browser
Species Human (GRCh38)
Location 5:645939-645961
Sequence AGCGTCACTCCTGCTCCCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 2, 1: 0, 2: 2, 3: 2, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571127_985571132 27 Left 985571127 5:645889-645911 CCCGTCGGCGGCCTGTGTGGACG No data
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71
985571131_985571132 16 Left 985571131 5:645900-645922 CCTGTGTGGACGGTGAATTCGGC 0: 1
1: 3
2: 1
3: 0
4: 28
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71
985571128_985571132 26 Left 985571128 5:645890-645912 CCGTCGGCGGCCTGTGTGGACGG No data
Right 985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG 0: 2
1: 0
2: 2
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571132 Original CRISPR AGCGTCACTCCTGCTCCCGT TGG Intronic