ID: 985571135

View in Genome Browser
Species Human (GRCh38)
Location 5:645954-645976
Sequence CATCCACACAGGGCGCCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571135_985571142 4 Left 985571135 5:645954-645976 CCCGTTGGCGCCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 985571142 5:645981-646003 ATTCGGCTTCCTTACACTGTGGG No data
985571135_985571141 3 Left 985571135 5:645954-645976 CCCGTTGGCGCCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 985571141 5:645980-646002 AATTCGGCTTCCTTACACTGTGG No data
985571135_985571144 27 Left 985571135 5:645954-645976 CCCGTTGGCGCCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG No data
985571135_985571145 30 Left 985571135 5:645954-645976 CCCGTTGGCGCCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 11
4: 73
Right 985571145 5:646007-646029 GTCACTCTTGCTCCCATCGGCGG 0: 1
1: 1
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571135 Original CRISPR CATCCACACAGGGCGCCAAC GGG (reversed) Intronic
902697986 1:18153304-18153326 CATCCACACACGGCCCTAATGGG + Intronic
915694115 1:157721858-157721880 CCTCCACACAGGGTCCCCACTGG - Intergenic
916037414 1:160933550-160933572 CTTCCACACAGGGCGGCGGCTGG - Intergenic
1066452887 10:35547689-35547711 CATCCACACAGGGCTCCGGCAGG - Intronic
1066684244 10:37965266-37965288 CCTCCACACAGAGCCCCCACTGG + Intronic
1067546817 10:47197718-47197740 CCTCCAGGCAGGGCACCAACTGG - Intergenic
1070637655 10:78142157-78142179 CAGCCACACAGAGCCCCCACCGG + Intergenic
1076202915 10:128572695-128572717 CATCCACAGAGGTGGCCCACTGG + Intergenic
1078189300 11:9078324-9078346 CTCTCACACAGGGCACCAACAGG + Intronic
1090088419 11:123671999-123672021 CCTCAACAGAGGGAGCCAACAGG - Intergenic
1103915220 12:124372498-124372520 CAGCCACCCTGGGCGCCGACGGG - Exonic
1105612406 13:21980535-21980557 CATCCACACAGGGCACCCTGAGG + Intergenic
1109003324 13:56835297-56835319 CTTCCACACAGGGTTCCCACTGG - Intergenic
1117639874 14:57786440-57786462 CCTCCTCACAGGAGGCCAACTGG + Intronic
1118063310 14:62164291-62164313 CATGCACACAGGGCCCCAGGAGG + Intergenic
1119444256 14:74650135-74650157 CAGGCACACAGGCGGCCAACAGG + Intergenic
1132715173 16:1286501-1286523 TCTCCCCACAGGGCGACAACGGG - Intergenic
1138853218 16:60655669-60655691 CATTCACACAGCTCACCAACTGG + Intergenic
1142836713 17:2593266-2593288 CCGCCACACACGGTGCCAACGGG + Intronic
1145868914 17:28257865-28257887 CACCCACACTGGGGGCCACCAGG - Intergenic
1148554114 17:48567637-48567659 CATCCAAAAAGGGAGCAAACGGG - Intronic
1151043561 17:70893531-70893553 CATGCACACAGGGCACCAATTGG - Intergenic
1152551331 17:81031900-81031922 CATGCACACAGGGCGCCGAGCGG - Intergenic
1152640572 17:81447626-81447648 CACCCACCCAGGGCGCTACCAGG + Exonic
1152649315 17:81484589-81484611 CGGCCACACAGGGCGCGAAGGGG - Intergenic
1155793048 18:29997911-29997933 CTCCCACACAGAGCGCCCACTGG + Intergenic
1157170440 18:45399738-45399760 CAACCACACAGGAAGACAACTGG + Intronic
1160515700 18:79478192-79478214 CAACCACACAGGAAGCCAACAGG + Intronic
1167314802 19:48757006-48757028 GATCCATACAGGGCCCCATCTGG - Exonic
927673624 2:25089252-25089274 CTTCCACACAGTGCCCCAAGGGG - Intronic
929808779 2:45170360-45170382 CATGCACACAAGGCGCCCGCGGG - Intergenic
930940948 2:57013738-57013760 CCTCCACACAGGGTCCCCACTGG + Intergenic
931247748 2:60505476-60505498 CATCCACACAGGGAACAAGCGGG + Intronic
933239640 2:79905728-79905750 CATGAACACAGGGCTCTAACAGG - Intronic
938839336 2:135143998-135144020 CAGCCACAGAGGGCCCCAGCGGG - Intronic
941570242 2:167161301-167161323 CACCCACACAGAGCCCCTACTGG - Intronic
943374766 2:187062766-187062788 CATCCCTACAGGGAGCCAGCTGG + Intergenic
945937689 2:215919708-215919730 AATCCATACAGGGCACCAAGTGG + Intergenic
1175736751 20:61392373-61392395 CATGATCACAGGGCGCCACCGGG + Intronic
1176245762 20:64095749-64095771 CAACCTCAAAGGGCCCCAACCGG + Intronic
1180096959 21:45560236-45560258 CAGCCACACAGGGCCCACACAGG + Intergenic
1180123627 21:45770786-45770808 CAGCCACACAGGGTGCCACATGG - Intronic
1180846277 22:18984189-18984211 CATCCACGCAGGGCCCCCACAGG + Intergenic
1180949118 22:19713396-19713418 CCTCCACCCAGGGAGCCCACGGG + Intergenic
1184688066 22:46105258-46105280 CAACCCCACAGGGCTCCCACAGG - Intronic
949965643 3:9353869-9353891 CATCCCCACAGGAATCCAACTGG + Intronic
957479034 3:80767774-80767796 CATCAACAGAGGGCACTAACAGG + Intergenic
961029683 3:123590808-123590830 CATCCACACAGAGTCCCCACTGG - Intergenic
961812261 3:129528647-129528669 CAGCCACTCAGGGCTCCAGCTGG - Exonic
962317308 3:134366979-134367001 CATCCACCCAGAGGGCCAGCTGG + Intronic
968874450 4:3257996-3258018 CAAACACACTGGGCTCCAACTGG + Intronic
973068598 4:45828736-45828758 CATCCACACAGAGCTCAACCAGG - Intergenic
976581308 4:86740181-86740203 CCTGCACACAGAGTGCCAACTGG - Intronic
977237487 4:94526252-94526274 CATCCAAACAGGGCAACATCTGG - Intronic
980525673 4:133988748-133988770 CACCCACACAGGGTCCCAACTGG - Intergenic
983472582 4:168174611-168174633 CAGCCACAGAGGTCTCCAACTGG + Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571135 5:645954-645976 CATCCACACAGGGCGCCAACGGG - Intronic
985571154 5:646084-646106 CATCCACACAGGCCGCCAATGGG - Intronic
985609329 5:878183-878205 CATCCACACAGGTCTGCCACAGG - Intronic
986760278 5:10874007-10874029 TATCCTCACATGGCGACAACAGG - Intergenic
987636196 5:20545336-20545358 CACCCACACAGAGTGCCCACTGG - Intronic
1001704058 5:173729128-173729150 AATCCCCACTGGGCGCCTACTGG + Intergenic
1002089796 5:176797786-176797808 CAGCCTCACAGGCCCCCAACAGG - Intergenic
1006622717 6:35377666-35377688 CAACCACAGAGGCAGCCAACAGG - Intronic
1009699762 6:67161086-67161108 CATCCACACAGAGCTCCCACTGG + Intergenic
1012649583 6:101736309-101736331 CATCCACACAGAGCCCCTACTGG - Intronic
1019833744 7:3359673-3359695 CATCCTCACAGCGCGCCACCCGG - Intronic
1021750601 7:23795499-23795521 CTCCCACACAGAGCCCCAACTGG + Intronic
1023868914 7:44252352-44252374 AAACCACACAGGGGGCCAAGAGG + Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1034269447 7:149796585-149796607 CCTCCACACAGGGTCCCCACCGG + Intergenic
1035821890 8:2602064-2602086 CATGCACACAGAGCCCCCACAGG + Intergenic
1046150530 8:110218600-110218622 CACCCACACAGGGGGACAATGGG - Intergenic
1049804461 8:144532640-144532662 CATCCACCCAGGGAGCCAGCAGG - Intronic
1051573187 9:18583524-18583546 CCTCCACACAGAGTGCCTACTGG + Intronic
1060213325 9:121723710-121723732 CATCCACACAGGGCCTCTAGGGG - Intronic
1062645425 9:137545493-137545515 CATCCACTCTGGGGGCCGACAGG + Intronic
1203793730 EBV:165072-165094 CGGCCACACAGGAGGCCAACAGG - Intergenic
1194112681 X:89854415-89854437 CATCCACAGAGGGTGCTATCAGG - Intergenic
1195470365 X:105222860-105222882 CCACCACACATGGCCCCAACAGG - Intronic
1198069375 X:133132832-133132854 CTCCCCCACAGGGCCCCAACAGG + Intergenic
1199314868 X:146365060-146365082 CATCATCACAGGGAACCAACCGG - Intergenic
1200009275 X:153109071-153109093 CATCCACACAGTGACCCAGCTGG + Intergenic
1200030325 X:153290851-153290873 CATCCACACAGTGACCCAGCTGG - Intergenic
1200465334 Y:3509226-3509248 CATCCACAGAGGGTGCTATCAGG - Intergenic