ID: 985571136

View in Genome Browser
Species Human (GRCh38)
Location 5:645955-645977
Sequence CCATCCACACAGGGCGCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571136_985571141 2 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571141 5:645980-646002 AATTCGGCTTCCTTACACTGTGG No data
985571136_985571145 29 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571145 5:646007-646029 GTCACTCTTGCTCCCATCGGCGG 0: 1
1: 1
2: 1
3: 4
4: 62
985571136_985571144 26 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG No data
985571136_985571142 3 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571142 5:645981-646003 ATTCGGCTTCCTTACACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571136 Original CRISPR CCATCCACACAGGGCGCCAA CGG (reversed) Intronic