ID: 985571136

View in Genome Browser
Species Human (GRCh38)
Location 5:645955-645977
Sequence CCATCCACACAGGGCGCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571136_985571145 29 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571145 5:646007-646029 GTCACTCTTGCTCCCATCGGCGG 0: 1
1: 1
2: 1
3: 4
4: 62
985571136_985571144 26 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG No data
985571136_985571142 3 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571142 5:645981-646003 ATTCGGCTTCCTTACACTGTGGG No data
985571136_985571141 2 Left 985571136 5:645955-645977 CCGTTGGCGCCCTGTGTGGATGG 0: 1
1: 1
2: 0
3: 5
4: 119
Right 985571141 5:645980-646002 AATTCGGCTTCCTTACACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571136 Original CRISPR CCATCCACACAGGGCGCCAA CGG (reversed) Intronic
901170123 1:7250945-7250967 CCATCATCGCAGGGAGCCAAAGG + Intronic
902697985 1:18153303-18153325 GCATCCACACACGGCCCTAATGG + Intronic
907306028 1:53513636-53513658 CCTACCACACAGGGGGCCAGTGG - Intronic
911112091 1:94199800-94199822 CAATCCACACAGGGCCACAAGGG - Intronic
913692534 1:121292960-121292982 CCATCCATACAGAGTGCCACAGG + Intronic
914145022 1:144987134-144987156 CCATCCATACAGAGTGCCACAGG - Intronic
920263128 1:204703192-204703214 CCACCCTCTCAGGGCCCCAAGGG + Intergenic
920479853 1:206311317-206311339 CCATCCATACAGAGTGCCACAGG + Intronic
924514846 1:244757309-244757331 CCGTCCACAAAAGGCACCAATGG - Intergenic
1074681629 10:115913306-115913328 CCATCCACACCAGCCCCCAAAGG + Intronic
1075417479 10:122275654-122275676 CAAGCCACCCAGGGCACCAATGG - Intronic
1077351387 11:2094791-2094813 CCATCCACCCAGGGGCCCCAGGG - Intergenic
1077424022 11:2466082-2466104 CCATCCACCCAGGGGGCTCAGGG + Intronic
1078162694 11:8855516-8855538 GCATCCCCACAGTGAGCCAACGG + Intronic
1079308352 11:19344255-19344277 CCCACCACACAGGGTGCCCAAGG - Intergenic
1079860930 11:25670133-25670155 CCAGCCACACAGGGCCACATGGG + Intergenic
1085031475 11:73273510-73273532 CCAGCCACACAGGGAGTCGAGGG - Intronic
1092259668 12:6946195-6946217 CCACCCACCCAGGGCGCTGAGGG - Intergenic
1096621392 12:52867867-52867889 CCAGCCACTCAGGGTGCCCAGGG + Intergenic
1101241838 12:102846866-102846888 CCATCCACCCAGGGAGAGAAGGG + Intronic
1103915221 12:124372499-124372521 CCAGCCACCCTGGGCGCCGACGG - Exonic
1113619153 13:111701287-111701309 CCACCAGCACAGGGGGCCAAGGG + Intergenic
1113624682 13:111786548-111786570 CCACCAGCACAGGGGGCCAAGGG + Intergenic
1114230860 14:20781230-20781252 CTATACACACAGGGCTCGAAGGG + Exonic
1114886984 14:26864829-26864851 CCATCCAGCCTGGGCGGCAAAGG + Intergenic
1119590634 14:75884327-75884349 CTAGCCACACAGGCCACCAAGGG - Intronic
1121455143 14:94033773-94033795 CCATCCACACAAGGCAGCAGAGG + Intronic
1122970906 14:105151841-105151863 CCCACCACACAGGACGCCAGAGG + Intronic
1132222629 15:100116544-100116566 CCCTCCACACATGGCGCCAGGGG + Intronic
1132376168 15:101329694-101329716 TCATCCACACAGGACTGCAAGGG - Intronic
1132715174 16:1286502-1286524 CTCTCCCCACAGGGCGACAACGG - Intergenic
1133150057 16:3821360-3821382 CCATCCACTCTGGGCCCCACAGG - Intronic
1136863831 16:33724206-33724228 TCATCCACTCATGGCACCAAAGG + Intergenic
1136863961 16:33726074-33726096 TCATCCACTCATGGCACCAAAGG + Intergenic
1203125317 16_KI270728v1_random:1572344-1572366 TCATCCACTCATGGCACCAAAGG + Intergenic
1203125447 16_KI270728v1_random:1574212-1574234 TCATCCACTCATGGCACCAAAGG + Intergenic
1142836711 17:2593265-2593287 CCCGCCACACACGGTGCCAACGG + Intronic
1148554115 17:48567638-48567660 CCATCCAAAAAGGGAGCAAACGG - Intronic
1150128697 17:62654543-62654565 CCATCCACAGAGGCAGCCAGAGG - Intronic
1150438209 17:65170374-65170396 CCTTCCACACAGGGCTGCAAAGG - Intronic
1152459180 17:80432381-80432403 CCATCCAGACAGGACTCCACAGG - Intronic
1152649316 17:81484590-81484612 GCGGCCACACAGGGCGCGAAGGG - Intergenic
1153675448 18:7452569-7452591 TCCTCCACACAGGGTGCCCAAGG + Intergenic
1154253185 18:12761275-12761297 CCATCCTCACAGGGCGCACCGGG - Intergenic
1156495948 18:37525155-37525177 CCATCCTCAGAGGGCGTCCAGGG - Intronic
1158208847 18:55023905-55023927 CCAGCCCCACAGGGCCCCACAGG + Intergenic
1160888395 19:1363391-1363413 CCATCCAGACAGGTGCCCAATGG - Intronic
1162029790 19:7912446-7912468 CCAGCCCCACAGGGGGCCAGGGG + Exonic
1162550565 19:11355977-11355999 GCAGCCACACGGGGGGCCAATGG - Intronic
1202703934 1_KI270713v1_random:6727-6749 CCAACCTCACAGGGCCCCACAGG - Intergenic
925702018 2:6648157-6648179 CCACCCACACTGGGCACCACAGG - Intergenic
926883806 2:17578557-17578579 TCATCCCCACAGGGTGCCAGAGG + Intronic
927673625 2:25089253-25089275 ACTTCCACACAGTGCCCCAAGGG - Intronic
929808780 2:45170361-45170383 CCATGCACACAAGGCGCCCGCGG - Intergenic
930217202 2:48709012-48709034 CCTTCCCCACAGGGAGCTAAAGG - Exonic
931664447 2:64600220-64600242 CCATCCACTCAGGGCACCCTAGG - Intergenic
933987151 2:87601712-87601734 CCTTCCACACAGAGCGTCAGAGG - Intergenic
934628585 2:95888762-95888784 TCATCCACTCATGGCACCAAAGG + Intronic
934628981 2:95894370-95894392 TCATCCACTCATGGCACCAAAGG + Intronic
934629391 2:95899982-95900004 TCATCCACTCATGGCACCAAAGG + Intronic
934629806 2:95905598-95905620 TCATCCACTCATGGCACCAAAGG + Intronic
934630211 2:95911215-95911237 TCATCCACTCATGGCACCAAAGG + Intronic
934630485 2:95914950-95914972 TCATCCACTCATGGCACCAAAGG + Intronic
934803708 2:97195925-97195947 TCATCCACTCATGGCACCAAAGG - Intronic
934804122 2:97201533-97201555 TCATCCACTCATGGCACCAAAGG - Intronic
934804404 2:97205271-97205293 TCATCCACTCATGGCACCAAAGG - Intronic
934804808 2:97210878-97210900 TCATCCACTCATGGCACCAAAGG - Intronic
934804943 2:97212753-97212775 TCATCCACTCATGGCACCAAAGG - Intronic
934832539 2:97544629-97544651 TCATCCACTCATGGCACCAAAGG + Intronic
936306690 2:111349096-111349118 CCTTCCACACAGAGCGTCAGAGG + Intergenic
936491613 2:112977448-112977470 CCATCCACATGGGGAGCCACAGG - Intronic
938839337 2:135143999-135144021 CCAGCCACAGAGGGCCCCAGCGG - Intronic
944457699 2:199911945-199911967 CTATGGACAAAGGGCGCCAAGGG - Intronic
946034480 2:216730995-216731017 CCAGCCACACTGGGTGCCAGTGG + Intergenic
948489388 2:238302816-238302838 CCCTCCACACACTGCCCCAACGG - Intergenic
948679987 2:239627157-239627179 CCAGCCACACAGGGAGCCCCCGG - Intergenic
948931690 2:241136313-241136335 CCATCTAAACATGGGGCCAAAGG - Intronic
1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG + Intergenic
1178948009 21:36964108-36964130 CCAGCTACTCAGGACGCCAAAGG + Intronic
1180008231 21:45033095-45033117 CCATCACCACAGGGCTCCCAGGG - Intergenic
1180949116 22:19713395-19713417 CCCTCCACCCAGGGAGCCCACGG + Intergenic
1184768784 22:46586297-46586319 CCATCCTCACTGGGCCCCACTGG + Intronic
955404273 3:58616049-58616071 CCATACACACTGGGCTCCACAGG - Intronic
959375571 3:105584644-105584666 CCACCCACAAAGGGTGTCAAGGG + Intergenic
961647549 3:128400593-128400615 CCAGCCCCACAGGGCCACAAAGG + Intronic
962035027 3:131642739-131642761 CCTTCCTCACATGGCGGCAAAGG - Intronic
962988326 3:140556421-140556443 CTGTCCATACAGGGCACCAAGGG - Intronic
967888025 3:194346333-194346355 CCACCCACAAGGGGTGCCAAGGG - Intronic
982850276 4:160306298-160306320 ACATCCACACAGGGCCACAGTGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571136 5:645955-645977 CCATCCACACAGGGCGCCAACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
987069877 5:14326161-14326183 CCATCCTCACAGTGAGCCAGGGG - Intronic
989016178 5:36937459-36937481 CCATGCACACAGATCTCCAACGG - Intronic
992252530 5:74889591-74889613 CCATGCAGAGAGGGAGCCAAAGG + Intergenic
993404956 5:87499894-87499916 CCAGCCACTCCGGGCGCCATAGG - Intergenic
994612082 5:102055886-102055908 CCATGCATATAGGGAGCCAAGGG + Intergenic
1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG + Intergenic
1007686933 6:43672490-43672512 CCATCCCCAAAGGAGGCCAAAGG - Exonic
1019287398 7:230500-230522 CCATCCACCCACGGCCCCACAGG - Intronic
1019536989 7:1534353-1534375 CCCTCCACACTGGGCCGCAAGGG - Intronic
1026913838 7:74108016-74108038 CCATCAACACAGGTCGGAAAAGG + Intronic
1041662669 8:60414539-60414561 CCAGCCACACAGGGCATCACCGG + Intergenic
1042176840 8:66045748-66045770 CCATCCTCAAAGGGCACCAGAGG + Intronic
1042679413 8:71365685-71365707 CCATCCAGACACGGTTCCAAAGG - Intergenic
1043865146 8:85365956-85365978 GCACCCACTCAGGGAGCCAAGGG - Intronic
1046150531 8:110218601-110218623 ACACCCACACAGGGGGACAATGG - Intergenic
1046460926 8:114535005-114535027 TCATCTACACTGGGCTCCAAGGG - Intergenic
1053098247 9:35347852-35347874 CCAGCCACACAGGGGGCAAATGG - Intronic
1053803736 9:41779867-41779889 CCACGCACACAGGGAGCCAGAGG - Intergenic
1054141534 9:61535256-61535278 CCACGCACACAGGGAGCCAGAGG + Intergenic
1054192036 9:61991259-61991281 CCACGCACACAGGGAGCCAGAGG - Intergenic
1054461231 9:65465973-65465995 CCACGCACACAGGGAGCCAGAGG + Intergenic
1054646343 9:67596531-67596553 CCACGCACACAGGGAGCCAGAGG + Intergenic
1056451749 9:86723371-86723393 CCTTTCACACGGGGCACCAAGGG - Intergenic
1060213326 9:121723711-121723733 TCATCCACACAGGGCCTCTAGGG - Intronic
1061990838 9:134157724-134157746 CCTTCGACACAGGGAGCCCAGGG - Intronic
1062110587 9:134780090-134780112 CCACCCGCACAGGGGGCCGATGG + Exonic
1062685335 9:137809851-137809873 CGGTCCACACAGGGCGGCATCGG - Intronic
1062685348 9:137809898-137809920 CGGTCCACACAGGGCGGCATCGG - Intronic
1062685361 9:137809945-137809967 CGGTCCACACAGGGCGGCATCGG - Intronic
1203582615 Un_KI270746v1:25731-25753 TCATCCACTCATGGCACCAAAGG - Intergenic
1187919971 X:24192019-24192041 CCATCCACACAGGGACCCTGAGG + Intronic
1191055343 X:56234110-56234132 ACATCCAAACAGGTGGCCAAAGG + Intronic
1201472327 Y:14347306-14347328 CCATGAACACAGGGCCCCTATGG - Intergenic