ID: 985571147

View in Genome Browser
Species Human (GRCh38)
Location 5:646019-646041
Sequence TGTCCACACAGGCCGCCGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571147_985571151 27 Left 985571147 5:646019-646041 CCCATCGGCGGCCTGTGTGGACA 0: 1
1: 0
2: 1
3: 6
4: 48
Right 985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG 0: 2
1: 0
2: 3
3: 16
4: 103
985571147_985571152 30 Left 985571147 5:646019-646041 CCCATCGGCGGCCTGTGTGGACA 0: 1
1: 0
2: 1
3: 6
4: 48
Right 985571152 5:646072-646094 GTCACTCTTGCTCCCATTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571147 Original CRISPR TGTCCACACAGGCCGCCGAT GGG (reversed) Intronic
901627699 1:10633130-10633152 TGGGCACACAGGGAGCCGATGGG - Intergenic
903440701 1:23385924-23385946 GGCCCACACAGGCCACAGATGGG - Intronic
904036561 1:27562133-27562155 TGCCCACACAGGCCTCCCCTCGG - Intronic
906509687 1:46403824-46403846 TGTCCACAAAGACCCCCCATGGG - Intronic
924775378 1:247112027-247112049 AGTCCACGCGGGCCGCCGAGAGG - Exonic
1069817271 10:71206389-71206411 TGGCCACACTGGCAGCTGATTGG - Intergenic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1083741235 11:64712704-64712726 TGACCACACAGGCTGCCCACAGG + Intronic
1089398004 11:118148395-118148417 GGTCCACAAAGGCCGCCGGAGGG + Intronic
1094472073 12:30812159-30812181 TAGCCACACTGGCAGCCGATTGG + Intergenic
1096922872 12:55107725-55107747 TAGCCACACTGGCAGCCGATTGG - Intergenic
1106136929 13:26980373-26980395 AGTCCACACAGGCCACCTCTGGG + Intergenic
1119668055 14:76498842-76498864 TGCCCACCCAGGCCACAGATGGG - Intronic
1123459837 15:20459657-20459679 TGTCCATACAGCCCCCCGTTGGG - Intergenic
1123658225 15:22540763-22540785 TGTCCATACAGCCCCCCGTTGGG + Intergenic
1124266068 15:28235494-28235516 TGTCCATACAGCCCCCCGTTGGG - Intronic
1124312090 15:28635255-28635277 TGTCCATACAGCCCCCCGTTGGG + Intergenic
1125541919 15:40474619-40474641 TGTCCCCACAGGCCTCTGAGGGG - Intergenic
1132205781 15:99985128-99985150 AGTCCACAGAGCCCGCCGCTGGG - Intronic
1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG + Intergenic
1136704248 16:32172914-32172936 TGTCCACACAGCCCCCCGTTGGG - Intergenic
1136763661 16:32756492-32756514 TGTCCACACAGCCCCCCGTTGGG + Intergenic
1136804438 16:33113894-33113916 TGTCCACACAGCCCCCCGTTGGG - Intergenic
1139652931 16:68371597-68371619 TGTCACCACAGGGCGGCGATGGG - Exonic
1142010009 16:87709154-87709176 TGTCGGCACAGGCCGCCTCTGGG + Intronic
1142388859 16:89784953-89784975 TCTCCACACAGGCCTCCTTTGGG - Exonic
1202997905 16_KI270728v1_random:134161-134183 TCTCCACACATACTGCCGATTGG + Intergenic
1203065811 16_KI270728v1_random:1016813-1016835 TGTCCACACAGCCCCCCGTTGGG + Intergenic
1145787361 17:27602979-27603001 TGTCCACACAGGCAGGAGAGAGG + Intronic
1151504262 17:74516207-74516229 TGGCCACACTGGCAGCTGATTGG + Intergenic
1152580141 17:81162196-81162218 TGTCCACACAGCCTTCCCATGGG + Intronic
1154131911 18:11744569-11744591 TGTGCACACAGCCCTCAGATGGG - Intronic
1160408407 18:78658911-78658933 TGTCCACACAGCCCCACGCTGGG - Intergenic
1162435457 19:10655045-10655067 TGTCCTCACAGGTCGCGGAGAGG + Intronic
1164675055 19:30095295-30095317 TGGCCACACAGGCCACAGAATGG + Intergenic
926812531 2:16768692-16768714 TGTGCACATAGTCCCCCGATAGG - Intergenic
927432048 2:23035033-23035055 TGTCCACACAGGTGTCCGGTGGG - Intergenic
937202315 2:120211948-120211970 TGTCCAAAAAGGCCTCCAATAGG + Intergenic
940207774 2:151223133-151223155 TAGCCACACTGGCAGCCGATTGG - Intergenic
947752520 2:232540307-232540329 AGTCCCCACAGGCCACCAATGGG - Intronic
1172354314 20:34269032-34269054 TGGCCACGCAGGGCGCAGATAGG - Exonic
954132730 3:48568588-48568610 TGGCCACACATGCAGCGGATGGG - Intronic
960574537 3:119217313-119217335 TGACCACATAGGCTGCTGATGGG + Intronic
961262681 3:125615300-125615322 TAGCCACACTGGCAGCCGATTGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571147 5:646019-646041 TGTCCACACAGGCCGCCGATGGG - Intronic
985571154 5:646084-646106 CATCCACACAGGCCGCCAATGGG - Intronic
988964439 5:36402280-36402302 TGTCAACACAGCCCTCAGATGGG - Intergenic
997688743 5:135810983-135811005 TGGCCACACAGGACGATGATCGG + Intergenic
1006845193 6:37056695-37056717 TTCCCACACAGGCAGCCGACAGG - Intergenic
1020271406 7:6598630-6598652 TGTGCACACAGGCAGCCTAAGGG + Intronic
1024866413 7:53908878-53908900 TAGCCACACTGGCAGCCGATTGG - Intergenic
1037104528 8:15090468-15090490 TGTCCAATCAGGCTGCCCATAGG + Intronic
1037506986 8:19540408-19540430 TATCCACACAGTGAGCCGATGGG - Intronic
1061225945 9:129281050-129281072 TGTCCACACAGGCCCCAGCTGGG - Intergenic
1199273310 X:145911657-145911679 TGTCCACACAGGAAGCAGTTAGG + Intergenic