ID: 985571148

View in Genome Browser
Species Human (GRCh38)
Location 5:646020-646042
Sequence CTGTCCACACAGGCCGCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571148_985571152 29 Left 985571148 5:646020-646042 CCATCGGCGGCCTGTGTGGACAG 0: 1
1: 1
2: 1
3: 7
4: 71
Right 985571152 5:646072-646094 GTCACTCTTGCTCCCATTGGCGG No data
985571148_985571151 26 Left 985571148 5:646020-646042 CCATCGGCGGCCTGTGTGGACAG 0: 1
1: 1
2: 1
3: 7
4: 71
Right 985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG 0: 2
1: 0
2: 3
3: 16
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571148 Original CRISPR CTGTCCACACAGGCCGCCGA TGG (reversed) Intronic