ID: 985571148

View in Genome Browser
Species Human (GRCh38)
Location 5:646020-646042
Sequence CTGTCCACACAGGCCGCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571148_985571151 26 Left 985571148 5:646020-646042 CCATCGGCGGCCTGTGTGGACAG 0: 1
1: 1
2: 1
3: 7
4: 71
Right 985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG 0: 2
1: 0
2: 3
3: 16
4: 103
985571148_985571152 29 Left 985571148 5:646020-646042 CCATCGGCGGCCTGTGTGGACAG 0: 1
1: 1
2: 1
3: 7
4: 71
Right 985571152 5:646072-646094 GTCACTCTTGCTCCCATTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571148 Original CRISPR CTGTCCACACAGGCCGCCGA TGG (reversed) Intronic
906509688 1:46403825-46403847 CTGTCCACAAAGACCCCCCATGG - Intronic
915141762 1:153772453-153772475 CCGTCTACACTGGACGCCGAGGG - Intronic
1069642320 10:69963881-69963903 CTGTCCACACTGGCCACCGCAGG - Intronic
1070603470 10:77881905-77881927 CTGTCCACAAAGGCCAAAGAGGG + Intronic
1073254472 10:102141909-102141931 CTGTCCACCCAGCCCGTCTAAGG + Exonic
1075440534 10:122476408-122476430 CTGTCCAGACAGGACCCAGATGG - Intronic
1078547963 11:12259932-12259954 CTGGCCCCTCAGGCTGCCGAGGG + Intronic
1079008778 11:16811542-16811564 CTGTCCCCACAGGCTGCAGGAGG + Intronic
1079104134 11:17559602-17559624 CTGTCCACACAGGATGCCCGGGG - Exonic
1084087342 11:66860613-66860635 CTGTCCACAGGGGCGGCCCAGGG + Intronic
1089398003 11:118148394-118148416 TGGTCCACAAAGGCCGCCGGAGG + Intronic
1097938520 12:65278976-65278998 CTGTCCCCGCAGGTGGCCGAGGG - Intronic
1114465375 14:22918651-22918673 GTGTCCTCTCAGGCCGCGGAGGG + Intronic
1116964572 14:51000726-51000748 CTGTCCACGGTGCCCGCCGATGG - Exonic
1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG + Intergenic
1119590634 14:75884327-75884349 CTAGCCACACAGGCCACCAAGGG - Intronic
1121278916 14:92686300-92686322 CTGCCCACACAGGCTGACTATGG + Intronic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1122003622 14:98684591-98684613 TTGTCCACACAGGCCTCCTTTGG - Intergenic
1122481321 14:102049327-102049349 CTGCCCACACAGGCGGCTGGCGG - Intronic
1125541920 15:40474620-40474642 TTGTCCCCACAGGCCTCTGAGGG - Intergenic
1129513597 15:76142823-76142845 CTCTGCACTCAGGCTGCCGATGG + Intronic
1131300250 15:91193321-91193343 CTGACCACACAGGCCAACGTCGG - Intronic
1132674787 16:1117116-1117138 CTGTCCCCACAGGCCCAGGATGG + Intergenic
1136704249 16:32172915-32172937 GTGTCCACACAGCCCCCCGTTGG - Intergenic
1136763660 16:32756491-32756513 GTGTCCACACAGCCCCCCGTTGG + Intergenic
1136804439 16:33113895-33113917 GTGTCCACACAGCCCCCCGTTGG - Intergenic
1140993146 16:80233701-80233723 CTGTCCACACAGGATTCCAAAGG - Intergenic
1141834548 16:86530131-86530153 CTGTCCCCACAGGCCTCCCTGGG + Intergenic
1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG + Intronic
1142388860 16:89784954-89784976 CTCTCCACACAGGCCTCCTTTGG - Exonic
1203065810 16_KI270728v1_random:1016812-1016834 GTGTCCACACAGCCCCCCGTTGG + Intergenic
1144666023 17:17102775-17102797 CTGTCCACAGAGGACTCTGAAGG + Intronic
1147324887 17:39665447-39665469 CTGTCCACACGGCCCGAGGAGGG + Exonic
1152580140 17:81162195-81162217 CTGTCCACACAGCCTTCCCATGG + Intronic
1155036066 18:22026083-22026105 CTGCCCACACTGGCCTCCCAAGG + Intergenic
1160837022 19:1129616-1129638 CTGCCCACCCAGGCTGCAGAGGG + Intronic
1164562334 19:29300801-29300823 CAGGCCACACAGGCAGCCGGCGG - Intergenic
1164573070 19:29387917-29387939 GTGTCCACACATGCCGCCGAGGG + Intergenic
926308638 2:11658575-11658597 CTCTCCACACAGGGAGCTGACGG + Exonic
927432049 2:23035034-23035056 CTGTCCACACAGGTGTCCGGTGG - Intergenic
932272003 2:70419109-70419131 CTCTTCACACAGGCCCCCTAAGG - Intergenic
941920837 2:170849274-170849296 CTGTCCCCACAGGCTGCCTGGGG + Exonic
943960504 2:194256657-194256679 TTCTCCTCACAGGCCGCCCATGG + Intergenic
946382435 2:219358343-219358365 CTGCCCACACAGCGCGCCGCAGG + Intergenic
947752521 2:232540308-232540330 CAGTCCCCACAGGCCACCAATGG - Intronic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG + Intronic
1178916817 21:36709458-36709480 CTGCCCCCACACCCCGCCGAAGG + Intronic
1179522848 21:41956351-41956373 GTGTGCACACAGGCCGCCTGCGG + Intergenic
1180071737 21:45440205-45440227 CTGTGCACACAGGCTCCCGCTGG + Intronic
950106656 3:10392954-10392976 CTGTCCACACGGGCCTCTGCCGG - Intronic
954428361 3:50455678-50455700 CTGTCCCCACAGCCCCCAGATGG + Intronic
962988326 3:140556421-140556443 CTGTCCATACAGGGCACCAAGGG - Intronic
969354473 4:6617368-6617390 CTGTCCCCAAAGGCCATCGAGGG + Exonic
969702092 4:8773323-8773345 CTGTCCACGTAGGACGCTGAAGG + Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571136 5:645955-645977 CCATCCACACAGGGCGCCAACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
986849625 5:11795882-11795904 ATGTCCACACAGGCCTCAGCAGG + Intronic
998931701 5:147188422-147188444 CTGTCCACACTGGGTACCGAGGG - Intergenic
1002401090 5:178991920-178991942 GTGTCCACGCTGGCCTCCGAGGG - Exonic
1006464211 6:34181696-34181718 CTGTCCACCCTGGCCTCCCAAGG - Intergenic
1007203936 6:40133675-40133697 ATGACCAGACAGGCCGCCTAGGG + Intergenic
1014349344 6:120320121-120320143 CTGTCCTCACAGCCCTCAGAAGG + Intergenic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1019547940 7:1587389-1587411 CTGCCCACCCCGGCCGCGGAGGG + Intergenic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1019690713 7:2409817-2409839 CTGTGCACAGAGGCAGGCGAGGG - Intronic
1020271405 7:6598629-6598651 CTGTGCACACAGGCAGCCTAAGG + Intronic
1036448926 8:8848104-8848126 CTTTCCACCCAGCCCGCCCAGGG + Intronic
1037672723 8:21029135-21029157 CTGGCCACACAGGACCCCAAGGG + Intergenic
1048922862 8:139246642-139246664 CTGTCCATACAGGGCCCCCAGGG + Intergenic
1057112168 9:92483516-92483538 CTGTCCTCTCAGGCCGGCCATGG - Intronic
1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG + Intergenic
1058676615 9:107405586-107405608 CTGTCCTCACAGGCCACCCCTGG - Intergenic
1061225946 9:129281051-129281073 CTGTCCACACAGGCCCCAGCTGG - Intergenic
1186553429 X:10531423-10531445 CTGGCAAGACAGGCCGCCGAGGG + Intronic
1190303136 X:49067771-49067793 CTGCCCCCAGAGGCTGCCGAAGG + Exonic
1199176338 X:144791757-144791779 TTCTCCACAGAGGCCGCCCATGG + Intergenic