ID: 985571154

View in Genome Browser
Species Human (GRCh38)
Location 5:646084-646106
Sequence CATCCACACAGGCCGCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571154_985571162 19 Left 985571154 5:646084-646106 CCCATTGGCGGCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 10
4: 79
Right 985571162 5:646126-646148 ACGGCGGTCGCTTTGCTTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 12
985571154_985571159 0 Left 985571154 5:646084-646106 CCCATTGGCGGCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 10
4: 79
Right 985571159 5:646107-646129 GTGAATTCGGCTTCTTTCCACGG No data
985571154_985571160 3 Left 985571154 5:646084-646106 CCCATTGGCGGCCTGTGTGGATG 0: 1
1: 0
2: 1
3: 10
4: 79
Right 985571160 5:646110-646132 AATTCGGCTTCTTTCCACGGCGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571154 Original CRISPR CATCCACACAGGCCGCCAAT GGG (reversed) Intronic
900791690 1:4684912-4684934 CATCCTCTGAGGCTGCCAATGGG - Intronic
902697986 1:18153304-18153326 CATCCACACACGGCCCTAATGGG + Intronic
904439217 1:30518885-30518907 CATCCAGACATGCCGTCACTTGG - Intergenic
905274991 1:36811730-36811752 CTTCCACACAGCCCTCCAGTTGG - Intronic
908085169 1:60624525-60624547 CAGCCACTCAGGCCTCCAGTTGG - Intergenic
911450211 1:98053090-98053112 CACACACACAGCCCGCCAAGTGG - Intergenic
911885733 1:103296771-103296793 CATGCACACAGGCTCCCAGTGGG - Intergenic
917771409 1:178283646-178283668 CATCCTCACAGACAGCCAGTTGG + Exonic
922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG + Intergenic
922998020 1:229982330-229982352 CTGCCACACAGGCACCCAATGGG + Intergenic
1070682592 10:78459315-78459337 CATCCACACACAACCCCAATAGG + Intergenic
1076325360 10:129616515-129616537 CATCCTCCCAGGCCCCCCATTGG + Intronic
1085446277 11:76603302-76603324 CATCCACACAGCCCTCCTTTGGG - Intergenic
1101964203 12:109271221-109271243 CATCCACACAGGCCACAGAAAGG + Intergenic
1114676200 14:24441996-24442018 CCTCCACCCAGTCAGCCAATTGG - Intronic
1117069273 14:52042155-52042177 CAGCCAAACAGGCCTCCAATTGG + Exonic
1119444256 14:74650135-74650157 CAGGCACACAGGCGGCCAACAGG + Intergenic
1120779182 14:88470748-88470770 CATCCACAGTGGCAGCCACTGGG - Intronic
1130387459 15:83424093-83424115 CCTCCACAGAAGCTGCCAATAGG + Intergenic
1135110272 16:19685527-19685549 CCTCCACGCAGACAGCCAATGGG - Intronic
1144874573 17:18390653-18390675 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1144874822 17:18391916-18391938 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1145157403 17:20552505-20552527 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1145157656 17:20553768-20553790 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1145759166 17:27416174-27416196 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1145799817 17:27675853-27675875 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1146845179 17:36178044-36178066 CAGCCACACAGGCCTGCAGTAGG + Intronic
1146857490 17:36265987-36266009 CAGCCACACAGGCCTGCAGTAGG + Intronic
1146863128 17:36322388-36322410 CAGCCACACAGGCCTGCAGTAGG - Intronic
1146873400 17:36389893-36389915 CAGCCACACAGGCCTGCAGTAGG + Intronic
1146880754 17:36440975-36440997 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1147065992 17:37922980-37923002 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1147076283 17:37990523-37990545 CAGCCACACAGGCCTGCAGTAGG + Intronic
1147077520 17:38002536-38002558 CAGCCACACAGGCCTGCAGTAGG - Intronic
1147087808 17:38070068-38070090 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1147093457 17:38126471-38126493 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1147103750 17:38194017-38194039 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1149848330 17:60020558-60020580 CAGCCACACAGGCCTGCAGTAGG + Intergenic
1149848586 17:60021821-60021843 CAGCCACACAGGCCTGCAATAGG + Intergenic
1149861583 17:60124703-60124725 CAGCCACACAGGCCTGCAATAGG - Intergenic
1149861839 17:60125966-60125988 CAGCCACACAGGCCTGCAGTAGG - Intergenic
1150086679 17:62277125-62277147 CAGCCACACAGGCCTGCAGTAGG + Intronic
1151043561 17:70893531-70893553 CATGCACACAGGGCACCAATTGG - Intergenic
1152551331 17:81031900-81031922 CATGCACACAGGGCGCCGAGCGG - Intergenic
1157991279 18:52499395-52499417 CTTCAAAACAGGCCGCTAATAGG - Intronic
1160515700 18:79478192-79478214 CAACCACACAGGAAGCCAACAGG + Intronic
1160888394 19:1363390-1363412 CATCCAGACAGGTGCCCAATGGG - Intronic
1163557021 19:17998704-17998726 CATGCACACAGGCAGCCACTAGG - Exonic
1167882117 19:52468717-52468739 TAGCCACACTGGCAGCCAATCGG - Intronic
925572496 2:5326540-5326562 CAGCCACACTGGCGGCCGATTGG + Intergenic
931911301 2:66902984-66903006 CAGCAACACAGACCACCAATGGG - Intergenic
941162975 2:162055935-162055957 CATCCACACTGGCCACCCAGTGG + Intronic
941755181 2:169177802-169177824 CATCCATATAGGCAGCCCATTGG - Exonic
942598805 2:177619021-177619043 CGTCCACACGGGCCGCGAGTCGG - Intergenic
947752520 2:232540307-232540329 AGTCCCCACAGGCCACCAATGGG - Intronic
948437858 2:237966343-237966365 CAATCACACAGGACGCTAATGGG + Intergenic
1171060710 20:21956754-21956776 CATCCACACATGCCACCTGTGGG - Intergenic
1176419986 21:6506339-6506361 CAGCCACACTGTCAGCCAATCGG - Intergenic
1179695477 21:43114659-43114681 CAGCCACACTGTCAGCCAATCGG - Intergenic
953787307 3:45920931-45920953 CATCCACACTGGCTGGCATTTGG + Exonic
971319556 4:25594386-25594408 CATCCTCACAGACAGCTAATAGG + Intergenic
972415252 4:38832939-38832961 CATCTACACATGCCTCCAAGGGG + Intronic
978702092 4:111659953-111659975 TACCCACACTGGCAGCCAATTGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571135 5:645954-645976 CATCCACACAGGGCGCCAACGGG - Intronic
985571147 5:646019-646041 TGTCCACACAGGCCGCCGATGGG - Intronic
985571154 5:646084-646106 CATCCACACAGGCCGCCAATGGG - Intronic
1000598864 5:163248262-163248284 TAGCCACACTGGCAGCCAATTGG - Intergenic
1002089796 5:176797786-176797808 CAGCCTCACAGGCCCCCAACAGG - Intergenic
1002540169 5:179901451-179901473 CATCCACACAGGCAGCGAGGAGG - Intronic
1006622717 6:35377666-35377688 CAACCACAGAGGCAGCCAACAGG - Intronic
1007636724 6:43304092-43304114 CATCCAGCAAGGCCGCCAGTGGG - Exonic
1013184304 6:107744813-107744835 CACCCAGACAGGCAGCCCATGGG + Intronic
1027678945 7:81194954-81194976 TAGCCACACTGGCAGCCAATTGG - Intronic
1028741148 7:94277305-94277327 CTTCCACACAGCCAGCCAATGGG + Intergenic
1032802509 7:135328244-135328266 CACCCATTCAGGCAGCCAATGGG + Intergenic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1037106201 8:15111408-15111430 CATCCACTCAGGCCTCTGATTGG + Intronic
1045380259 8:101616819-101616841 CATCCACACAAGCCCACAATGGG - Intronic
1046150530 8:110218600-110218622 CACCCACACAGGGGGACAATGGG - Intergenic
1050157868 9:2686806-2686828 CATCCACTCAGGCAGTGAATTGG + Intergenic
1052970597 9:34375059-34375081 CATACACACAGCCAGCCAGTTGG + Intronic
1057942769 9:99299268-99299290 CATCCCCACAGACCTCCAAAGGG + Intergenic
1058340307 9:103887312-103887334 CAGCCACACTAGCAGCCAATTGG + Intergenic
1060213134 9:121722620-121722642 CAGCCACACAGACAGCCAGTGGG + Intronic
1060627417 9:125126288-125126310 CAGCCACCCAGGCAGCCCATGGG - Intronic
1061189632 9:129074706-129074728 CCACCACAAAGGCCGCCTATTGG - Intergenic
1061382099 9:130264918-130264940 CATCCACACATGCAGCCCATGGG + Intergenic
1186482690 X:9908022-9908044 CATCCAGACAGACTGCCACTGGG - Intronic
1190118110 X:47638921-47638943 CCTCCAGACAGGCCTCCAAGGGG + Exonic
1200981589 Y:9267560-9267582 CATACAGACAGGCCACCAAAAGG + Intergenic