ID: 985571155

View in Genome Browser
Species Human (GRCh38)
Location 5:646085-646107
Sequence CCATCCACACAGGCCGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571155_985571160 2 Left 985571155 5:646085-646107 CCATTGGCGGCCTGTGTGGATGG 0: 1
1: 1
2: 1
3: 5
4: 115
Right 985571160 5:646110-646132 AATTCGGCTTCTTTCCACGGCGG 0: 1
1: 0
2: 0
3: 4
4: 40
985571155_985571162 18 Left 985571155 5:646085-646107 CCATTGGCGGCCTGTGTGGATGG 0: 1
1: 1
2: 1
3: 5
4: 115
Right 985571162 5:646126-646148 ACGGCGGTCGCTTTGCTTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 12
985571155_985571159 -1 Left 985571155 5:646085-646107 CCATTGGCGGCCTGTGTGGATGG 0: 1
1: 1
2: 1
3: 5
4: 115
Right 985571159 5:646107-646129 GTGAATTCGGCTTCTTTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571155 Original CRISPR CCATCCACACAGGCCGCCAA TGG (reversed) Intronic