ID: 985571155

View in Genome Browser
Species Human (GRCh38)
Location 5:646085-646107
Sequence CCATCCACACAGGCCGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985571155_985571159 -1 Left 985571155 5:646085-646107 CCATTGGCGGCCTGTGTGGATGG 0: 1
1: 1
2: 1
3: 5
4: 115
Right 985571159 5:646107-646129 GTGAATTCGGCTTCTTTCCACGG No data
985571155_985571162 18 Left 985571155 5:646085-646107 CCATTGGCGGCCTGTGTGGATGG 0: 1
1: 1
2: 1
3: 5
4: 115
Right 985571162 5:646126-646148 ACGGCGGTCGCTTTGCTTCGTGG 0: 1
1: 0
2: 0
3: 1
4: 12
985571155_985571160 2 Left 985571155 5:646085-646107 CCATTGGCGGCCTGTGTGGATGG 0: 1
1: 1
2: 1
3: 5
4: 115
Right 985571160 5:646110-646132 AATTCGGCTTCTTTCCACGGCGG 0: 1
1: 0
2: 0
3: 4
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985571155 Original CRISPR CCATCCACACAGGCCGCCAA TGG (reversed) Intronic
900791691 1:4684913-4684935 CCATCCTCTGAGGCTGCCAATGG - Intronic
901444442 1:9299252-9299274 CCATCAGCCCAGACCGCCAAGGG - Intronic
901477018 1:9496811-9496833 CCATCAGCCCAGACCGCCAAGGG + Intergenic
902471536 1:16649932-16649954 CCAACCTCACAGGCCCCCACAGG - Intergenic
902487273 1:16757513-16757535 CCAACCTCACAGGCCCCCACAGG + Intronic
903552810 1:24169716-24169738 CCGTCCAGACAGGCAGCCACTGG + Intronic
904633498 1:31861306-31861328 CCATCCACCTAGGCCTCCCAAGG + Intergenic
910899218 1:92101520-92101542 CCTGCCACACAGTCCCCCAAGGG + Intronic
911112091 1:94199800-94199822 CAATCCACACAGGGCCACAAGGG - Intronic
915330812 1:155111350-155111372 CCAGCCACACAGCCAGCCTAGGG + Intergenic
918156880 1:181856285-181856307 TCAGCCACACAGGCAGCCATTGG - Intergenic
922998019 1:229982329-229982351 CCTGCCACACAGGCACCCAATGG + Intergenic
923705788 1:236343717-236343739 CCATGCACAAAGGCCCCAAAGGG + Intergenic
1062998363 10:1890381-1890403 CCAGGCACACAGCCAGCCAATGG - Intergenic
1067430633 10:46241186-46241208 CACTCCACACATGCTGCCAAGGG + Intergenic
1067741004 10:48896201-48896223 CCAGTCAGACATGCCGCCAAGGG + Intronic
1068948110 10:62749757-62749779 CCATCCACAATGGCTTCCAAAGG + Intergenic
1069832894 10:71291780-71291802 CCTCCCACCCAGGCAGCCAAAGG - Exonic
1074681629 10:115913306-115913328 CCATCCACACCAGCCCCCAAAGG + Intronic
1077164437 11:1128827-1128849 CCAGCCACACAGGCCGTCTGAGG + Intergenic
1078246486 11:9576637-9576659 TCATCAACAGAGCCCGCCAATGG - Exonic
1083151079 11:60792149-60792171 CCTGCCCCACTGGCCGCCAAGGG + Intronic
1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG + Intronic
1087385328 11:97462519-97462541 CTATTCTCACAGGCCTCCAAAGG - Intergenic
1088669682 11:112128951-112128973 CCATCCACACAGCCCTCCTCGGG + Intronic
1090804406 11:130194013-130194035 CCATCCACAGAGGCCAAGAATGG - Intronic
1090972325 11:131654304-131654326 CCATCCACCCCCACCGCCAAAGG + Intronic
1091884210 12:4004082-4004104 CCATCCACACAGCCACCCATGGG + Intergenic
1099333448 12:81322125-81322147 CCAACCACACAGGCCAGTAATGG - Intronic
1104326743 12:127805853-127805875 GCATCCACTCTGGCCACCAAAGG - Intergenic
1106208908 13:27622646-27622668 CCATCCACACTGGCCACAAGGGG - Intronic
1113240924 13:108336084-108336106 CCAGCAACACAGGCAGCCCAGGG + Intergenic
1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG + Intergenic
1115085687 14:29512623-29512645 CCCTCCCAACAGTCCGCCAAAGG + Intergenic
1119590634 14:75884327-75884349 CTAGCCACACAGGCCACCAAGGG - Intronic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1122970906 14:105151841-105151863 CCCACCACACAGGACGCCAGAGG + Intronic
1127389409 15:58493100-58493122 CCATCCACCCTGGCCCCCCATGG + Intronic
1129070541 15:72946656-72946678 CCACCCACACATGCCACCTAGGG + Intergenic
1132222629 15:100116544-100116566 CCCTCCACACATGGCGCCAGGGG + Intronic
1132345975 15:101109025-101109047 GCATCCACACTGGCTGCCCACGG + Intergenic
1132376168 15:101329694-101329716 TCATCCACACAGGACTGCAAGGG - Intronic
1136344268 16:29664851-29664873 CCATCCTCACTGGCCACCAGTGG - Exonic
1137745182 16:50815404-50815426 CCATCCACACCAGCTGCCAGAGG - Intergenic
1139300386 16:65940513-65940535 CCATCCAAACACGCCGTTAAAGG + Intergenic
1141763602 16:86044648-86044670 CCATCCCTAGAGGCAGCCAAAGG - Intergenic
1142157321 16:88538497-88538519 CCGTCGGGACAGGCCGCCAACGG - Intergenic
1143565581 17:7718401-7718423 TCATCCCCACAGGCTGCCACAGG - Exonic
1148744163 17:49909249-49909271 CCATCTACACAGGCCCACAGTGG + Intergenic
1149537345 17:57443058-57443080 CCAGGCAGACAGGCCGCAAACGG - Intronic
1150128697 17:62654543-62654565 CCATCCACAGAGGCAGCCAGAGG - Intronic
1150438209 17:65170374-65170396 CCTTCCACACAGGGCTGCAAAGG - Intronic
1152459180 17:80432381-80432403 CCATCCAGACAGGACTCCACAGG - Intronic
1153608858 18:6861526-6861548 CCAGCTACAGAGGCCGACAAGGG - Intronic
1160514388 18:79470534-79470556 CCATCCCCACAGGCAGCACAGGG + Intronic
1160888395 19:1363391-1363413 CCATCCAGACAGGTGCCCAATGG - Intronic
1161991380 19:7686176-7686198 CCATCCCCACCGGCCACCGAGGG + Exonic
1163813129 19:19447163-19447185 CCCTCCACACATGCCCCCCAGGG - Intronic
1164649742 19:29883092-29883114 CCATCCACAGCGGCTGCCCACGG + Intergenic
1168435076 19:56310229-56310251 CCCTCCACACAGGCAGTCCAGGG - Intronic
946634081 2:221705351-221705373 CCATCCACACAGGCACTGAATGG + Intergenic
947374200 2:229479275-229479297 CCTTTCACACAGTCCGCCTAAGG + Intronic
947752521 2:232540308-232540330 CAGTCCCCACAGGCCACCAATGG - Intronic
1171060711 20:21956755-21956777 CCATCCACACATGCCACCTGTGG - Intergenic
1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG + Intergenic
1174056738 20:47803349-47803371 CCATGCTCACAGGCAGCCAGAGG - Intergenic
1174742174 20:53025768-53025790 CAGTGCACACAGGCCCCCAAAGG + Intronic
1178948009 21:36964108-36964130 CCAGCTACTCAGGACGCCAAAGG + Intronic
1179066473 21:38029159-38029181 CTACCCACTCAGGCCACCAAGGG - Intronic
1181331185 22:22092748-22092770 CTATGCACACAGGCTGCAAAAGG + Intergenic
1183605115 22:38863557-38863579 CCATCCACTCGGGCCCCCATGGG + Exonic
1184098466 22:42329266-42329288 CCCAGCACACAGGCTGCCAAGGG + Intronic
952925520 3:38316775-38316797 CCATCCAGACAGGCAGGCAGGGG - Intronic
954297887 3:49684309-49684331 CCAACCTCACAGGCCCCCACAGG + Exonic
956276761 3:67510469-67510491 TCAACCACACAGGCCCCCAGTGG + Intronic
966607308 3:181834273-181834295 ACCTCCACACAGGCCAGCAAAGG - Intergenic
971268556 4:25115679-25115701 GCCTCCACACAGGCTCCCAAAGG - Intergenic
972415251 4:38832938-38832960 ACATCTACACATGCCTCCAAGGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571136 5:645955-645977 CCATCCACACAGGGCGCCAACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
987510072 5:18825600-18825622 CCACCCACACTGGCCTCCCAAGG + Intergenic
989016178 5:36937459-36937481 CCATGCACACAGATCTCCAACGG - Intronic
994848496 5:105021794-105021816 CCATCAACACTGGCCTGCAAAGG + Intergenic
996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG + Intergenic
1004024191 6:11803263-11803285 CCACCCACACAGGCCGTCTGGGG + Intronic
1004281539 6:14283755-14283777 CCATCCACACTGCCCTCTAAGGG - Intergenic
1007231329 6:40349382-40349404 CCATCCCCACAGCCCTCCACAGG + Intergenic
1007636725 6:43304093-43304115 CCATCCAGCAAGGCCGCCAGTGG - Exonic
1007686933 6:43672490-43672512 CCATCCCCAAAGGAGGCCAAAGG - Exonic
1007746547 6:44046792-44046814 CCACCCTCACAGCCAGCCAAAGG + Intergenic
1019310619 7:358970-358992 CCCTCCACACATGCCCCCACAGG + Intergenic
1019346894 7:535508-535530 CCAGCCACCCAGGCCAGCAAGGG + Intergenic
1019376727 7:696823-696845 CCATACACACAGGCCGCTTCAGG + Intronic
1020085883 7:5310025-5310047 CCATCAACTCAGGCGGCCGAGGG - Intronic
1022691706 7:32662458-32662480 CCATGCACACAGCCCTTCAATGG + Intergenic
1022919322 7:34996682-34996704 CCATGCACACAGCCCTTCAATGG + Intronic
1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG + Exonic
1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG + Intergenic
1025236271 7:57236830-57236852 CCATGCTCACAGGCAGCCAGAGG + Intergenic
1025663529 7:63569753-63569775 CCATCAACTCAGGCGGCCGAGGG - Intergenic
1026913838 7:74108016-74108038 CCATCAACACAGGTCGGAAAAGG + Intronic
1028741147 7:94277304-94277326 ACTTCCACACAGCCAGCCAATGG + Intergenic
1032802508 7:135328243-135328265 CCACCCATTCAGGCAGCCAATGG + Intergenic
1034261751 7:149761170-149761192 CCATCACCACAGGCCTCCAGTGG + Intergenic
1039775931 8:40736742-40736764 CCATCCTCACAGACTGCCAGAGG - Intronic
1040318549 8:46277523-46277545 CCATCCACACAGGCCTGCCTGGG + Intergenic
1041462058 8:58121911-58121933 CCATCCAGAAGGGCAGCCAAAGG - Intronic
1044107198 8:88224079-88224101 CCTTCCTCACAGTCCGCCAGAGG - Intronic
1045380260 8:101616820-101616842 ACATCCACACAAGCCCACAATGG - Intronic
1046665257 8:116995349-116995371 CCATCCAAATAGGCCACCTAGGG + Intronic
1048924301 8:139256977-139256999 CCATCCACACATGCATGCAAGGG - Intergenic
1049598153 8:143494115-143494137 CCATCCCCACAGGCCTCCCCAGG + Intronic
1052626113 9:30979037-30979059 CCTTCCCAACAGGCCCCCAAAGG - Intergenic
1053098247 9:35347852-35347874 CCAGCCACACAGGGGGCAAATGG - Intronic
1054648977 9:67611456-67611478 ACATCCACACAGGCAGACCAGGG + Intergenic
1057942768 9:99299267-99299289 TCATCCCCACAGACCTCCAAAGG + Intergenic
1060758686 9:126230622-126230644 CCAGCCACACAGGCCTGCCAAGG + Intergenic
1061382098 9:130264917-130264939 GCATCCACACATGCAGCCCATGG + Intergenic
1190118108 X:47638920-47638942 GCCTCCAGACAGGCCTCCAAGGG + Exonic
1191055343 X:56234110-56234132 ACATCCAAACAGGTGGCCAAAGG + Intronic
1192239706 X:69319429-69319451 CCCTCCACACAGACCCCCAGGGG + Intergenic