ID: 985572052

View in Genome Browser
Species Human (GRCh38)
Location 5:652142-652164
Sequence TACCTTGACCTGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985572052_985572062 30 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572062 5:652195-652217 GGCCTGGATGTGGACAAGGCAGG 0: 1
1: 0
2: 3
3: 26
4: 285
985572052_985572058 14 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572058 5:652179-652201 TCTCCTTGAGCACTGTGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 220
985572052_985572060 20 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572060 5:652185-652207 TGAGCACTGTGGCCTGGATGTGG 0: 1
1: 0
2: 1
3: 35
4: 314
985572052_985572057 9 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572057 5:652174-652196 GTCATTCTCCTTGAGCACTGTGG 0: 1
1: 0
2: 3
3: 28
4: 160
985572052_985572061 26 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572061 5:652191-652213 CTGTGGCCTGGATGTGGACAAGG 0: 1
1: 0
2: 4
3: 53
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985572052 Original CRISPR TACCTTGACCTGCCACAGAC AGG (reversed) Intronic
901583441 1:10265482-10265504 CACCTTGACCTCCCAAAGAGTGG + Intronic
903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG + Intergenic
903831708 1:26179162-26179184 TACCTTGTCCAGGCACAGGCCGG + Intronic
903953732 1:27011273-27011295 TACCTTGGCTTCCCACAGAGGGG - Intronic
905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG + Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
907436751 1:54454595-54454617 TACCTTGACCTCCCAAAGTGCGG + Intergenic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
912718985 1:112003992-112004014 TACCCTGACCTTCCATAGAAGGG + Intergenic
912725631 1:112056949-112056971 TACCTTGACCTGCAACTTCCTGG + Intergenic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
922853544 1:228755163-228755185 TACCTGGACCTCCCTCAGACAGG - Intergenic
923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG + Intronic
1065378053 10:25062633-25062655 TACCTTGATCAGCCACACTCAGG + Intergenic
1070120385 10:73570658-73570680 CACCTTGACCTCCCAAAGGCTGG + Intronic
1071556882 10:86611225-86611247 TACCTTGACCTCCCAAAGTGTGG + Intergenic
1073457615 10:103647102-103647124 TATCTTGGCCTGCCACAGCCAGG - Intronic
1077474551 11:2780215-2780237 GTCCTTGCCCTGCCACTGACTGG + Intronic
1080821014 11:35806580-35806602 TTCCTTGACCTACCACAACCAGG - Exonic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1085937098 11:81159883-81159905 TACCTAGGCCTCCCACAGGCGGG + Intergenic
1088916198 11:114229776-114229798 TACCAGGACCTAACACAGACTGG + Intronic
1091487177 12:900651-900673 TACCTTGACCTGGAGCAGAAAGG - Exonic
1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG + Intronic
1094133182 12:27097022-27097044 TGCCTTGACCTCCCAGAAACTGG - Intergenic
1094183004 12:27612233-27612255 TACCTTGACCTCCCAGAAACTGG - Intronic
1095513558 12:42980287-42980309 AACCCTGAGTTGCCACAGACTGG - Intergenic
1095888711 12:47215638-47215660 TATCTTGCTCTGCCACATACTGG + Intronic
1100016535 12:90017267-90017289 AACCTATACCTGCCACAGATTGG - Intergenic
1102360718 12:112285332-112285354 TCCCTAGACCTTCCAGAGACTGG + Intronic
1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG + Intergenic
1106467815 13:30028452-30028474 CACCTTGGCCTTCCACAAACTGG - Intergenic
1108502833 13:51084117-51084139 TTCCTTGACGTGTCTCAGACTGG - Intergenic
1108559258 13:51627071-51627093 TACCTGGTCCAGCCACAGGCTGG - Intronic
1108596524 13:51954672-51954694 TACCTTTGCCTGAGACAGACAGG + Intronic
1116873565 14:50090430-50090452 TCCCTTGACCTCCCCCAAACAGG + Intronic
1118898093 14:69963699-69963721 CACCTTGACCTCCCACAGGAAGG - Intronic
1119722265 14:76899219-76899241 TCCCTTTACCTGCCACAATCTGG - Intergenic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1125758346 15:42081131-42081153 TACCTGGACCACACACAGACAGG + Exonic
1127573047 15:60262820-60262842 TACCTTGACCTCCCAGACTCAGG + Intergenic
1127899512 15:63330602-63330624 TACCCCCACCAGCCACAGACTGG - Intronic
1128037639 15:64540690-64540712 TACCGTGTCCGGCCACAGATAGG + Intronic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1135659187 16:24279738-24279760 TACCTTTACATGCAACAGTCAGG - Intronic
1137512326 16:49112454-49112476 TGCCCTGACCTGCCTCAGAGTGG - Intergenic
1140305009 16:73794720-73794742 TACCTTTTCCTGCAACAGATGGG + Intergenic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1141649650 16:85386076-85386098 AACCCTGACCTGTCACAGAGAGG - Intergenic
1141889180 16:86915209-86915231 TTCCTTGACTTGGCACAGCCGGG - Intergenic
1148317754 17:46718245-46718267 TTTCTTGTCATGCCACAGACTGG + Intronic
1152848057 17:82614436-82614458 CACCTTGTCCTGTCACAGGCCGG + Intronic
1154013432 18:10595269-10595291 TACGTTGTCCAGCCAGAGACAGG + Intergenic
1156448948 18:37255737-37255759 TACCTTGTCCTGGCAGGGACAGG - Intronic
1156598071 18:38570808-38570830 TTCCCTGACCTGTCACAGAATGG - Intergenic
1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG + Intronic
1161092983 19:2372103-2372125 TGCCTTGACCTCCCAAAGTCTGG + Intergenic
1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG + Intergenic
931137636 2:59421919-59421941 TTCCTGGAATTGCCACAGACAGG - Intergenic
933525818 2:83437285-83437307 CACATTGACCTCCCTCAGACAGG - Intergenic
933811467 2:86035393-86035415 AGTCCTGACCTGCCACAGACTGG + Intronic
936252118 2:110874974-110874996 TCCCTTGTCCTGCCACCGGCAGG + Intronic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
945637188 2:212370099-212370121 TACCTGGACCTGCCCTTGACAGG - Intronic
946571595 2:221029746-221029768 TACCTTTGCCTGACACAGTCAGG - Intergenic
1174190126 20:48734670-48734692 TACCATGACCTGCCTCCCACAGG - Intronic
1177963836 21:27702653-27702675 CACCTTGACCTGCCAAAGTGTGG - Intergenic
1178661838 21:34513407-34513429 GACCATAACCTACCACAGACAGG + Intronic
1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG + Intronic
949101918 3:155862-155884 TACATAGACCTGCCAGTGACTGG - Intergenic
949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG + Intronic
954198826 3:49012310-49012332 AAGCTTGACCTGCCACACACGGG - Exonic
955612671 3:60774547-60774569 CACCTTGACCTCCCAAAGAGTGG + Intronic
956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG + Intronic
959528393 3:107403352-107403374 TACAATGAACTGCCATAGACTGG - Intergenic
959630197 3:108499039-108499061 TACTTTGACCTGCCCCAATCTGG + Intronic
962285131 3:134078940-134078962 AACCTTTCCCAGCCACAGACTGG + Intronic
965755606 3:172023340-172023362 TTCCTTGACCTGCCAGAAAGTGG + Intergenic
969078671 4:4601325-4601347 TACCTTGATCTGCCAGATGCAGG - Intergenic
972635178 4:40877863-40877885 TATCATGACCTGCCACACCCCGG + Intronic
977453376 4:97226483-97226505 TAGCTTGGCCTGACAGAGACAGG + Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG + Intergenic
979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG + Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986463004 5:7992688-7992710 TACCATAACATACCACAGACTGG + Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
995491262 5:112693861-112693883 TACCTTGAACTGAAAGAGACAGG - Intergenic
1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG + Intergenic
1002716643 5:181232222-181232244 TACCATGAGCTCCCACTGACAGG - Intronic
1007480379 6:42145777-42145799 TGCCGTGACCTCCCACACACTGG - Intergenic
1007620443 6:43210223-43210245 CACCTTGGCCTGCCAAAGTCTGG + Intronic
1017289078 6:152713848-152713870 TAGCTTTACCTGTCCCAGACTGG + Intronic
1021299316 7:18952784-18952806 AACCTTGTACTGCCACAGAGCGG + Intronic
1023185549 7:37529263-37529285 TACCTAGACCTGGCACATATGGG - Intergenic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1031101510 7:117486452-117486474 TTCCTTGACCAGCCTTAGACTGG - Intronic
1035163823 7:156971584-156971606 TACCTTGGCCTCCCAAACACCGG + Exonic
1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG + Intronic
1041691659 8:60693519-60693541 AACCTTGCCCTGCCCAAGACAGG - Intronic
1043632205 8:82349809-82349831 TACCTTGACCTGGCCTAGATTGG - Intergenic
1046314710 8:112483979-112484001 CACCTTGACCTTCAACAGCCAGG - Intronic
1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG + Intergenic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1060535332 9:124382008-124382030 TACCTTGGCCTCCCAAAGGCTGG - Intronic
1061746071 9:132741117-132741139 TGCCGTGACCTGGCACAGACTGG - Intronic
1061900543 9:133669887-133669909 GGCCTAGACCTGCCACAGAGGGG + Intronic