ID: 985572058

View in Genome Browser
Species Human (GRCh38)
Location 5:652179-652201
Sequence TCTCCTTGAGCACTGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985572049_985572058 23 Left 985572049 5:652133-652155 CCTGGTGGGCCTGTCTGTGGCAG 0: 1
1: 1
2: 4
3: 27
4: 286
Right 985572058 5:652179-652201 TCTCCTTGAGCACTGTGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 220
985572052_985572058 14 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572058 5:652179-652201 TCTCCTTGAGCACTGTGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 220
985572047_985572058 30 Left 985572047 5:652126-652148 CCTGGAACCTGGTGGGCCTGTCT 0: 1
1: 0
2: 5
3: 15
4: 185
Right 985572058 5:652179-652201 TCTCCTTGAGCACTGTGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985572058 Original CRISPR TCTCCTTGAGCACTGTGGCC TGG Intronic
900156587 1:1205667-1205689 TCTCCTGGGGCCATGTGGCCTGG + Intronic
900361216 1:2289945-2289967 TGTCCTGGAGCAACGTGGCCTGG - Intronic
901465633 1:9419112-9419134 GGCCCTTGAGCACTGTGGTCAGG - Intergenic
901923525 1:12552306-12552328 GCTCTTTGAGGACTGGGGCCTGG + Intergenic
902097739 1:13960485-13960507 TCACCTTCATCTCTGTGGCCCGG - Intergenic
902116211 1:14123816-14123838 TGTCCTTGACCACTGAGACCAGG - Intergenic
902667899 1:17952386-17952408 GCTCCTTGGGGACTGTGGGCCGG + Intergenic
903803822 1:25989976-25989998 TGTCCTAGAGCAGAGTGGCCTGG - Intronic
904858144 1:33515394-33515416 TCTACAGTAGCACTGTGGCCAGG - Exonic
911179602 1:94848957-94848979 TTCCCTTGACCTCTGTGGCCAGG - Intronic
912795372 1:112689892-112689914 GCTCCCAGAGCACTGTGGCTGGG - Exonic
914718229 1:150268730-150268752 TTTTCTTGATCACTGTGGCTGGG - Exonic
918697829 1:187566088-187566110 TGTCCTTGAACTCTGTGGTCTGG - Intergenic
920313020 1:205059448-205059470 TCTCCTTGAGGCCTGGGGCAAGG - Intronic
922155319 1:223036502-223036524 CCTGCTTGAGCACTGTGGCTTGG + Intergenic
922582928 1:226712009-226712031 TCTCCCGGAGCTCTGAGGCCAGG - Intronic
923017233 1:230136353-230136375 TCTCCTGGAGCTCTATGGCAGGG - Intronic
924931945 1:248739923-248739945 TCACCTGCAGCACGGTGGCCCGG + Intronic
1064849016 10:19688655-19688677 TCCCCCTGAGTACTGTGGGCTGG - Intronic
1067169830 10:43897583-43897605 TGTCCTGGAGCACAGTGTCCAGG + Intergenic
1069116998 10:64519844-64519866 TCTTCTTAAACACTGTGGTCAGG - Intergenic
1069410706 10:68150458-68150480 TCTCCTTGAGCACCTAAGCCAGG - Intronic
1069819673 10:71219702-71219724 CCTCCTCGAGGGCTGTGGCCAGG - Intronic
1069910498 10:71755828-71755850 TGACCTTGAGCTCTGTGGCATGG - Intronic
1070375995 10:75831657-75831679 TCTACTAGGGCAATGTGGCCAGG - Intronic
1070420070 10:76227948-76227970 ACTCTGTGAGCACTGTAGCCTGG - Intronic
1073185020 10:101610801-101610823 ATTCCTGGGGCACTGTGGCCTGG - Exonic
1074185595 10:111097531-111097553 TGTCCATCAGCACTGTGGCAAGG - Intergenic
1074896899 10:117784980-117785002 TCCCCTTGAGCACCCAGGCCTGG + Intergenic
1076358378 10:129869122-129869144 TCTCTTGGAGGACTGAGGCCTGG - Intronic
1076452903 10:130569077-130569099 GCTCCTTGTGCACAGTGGCTGGG + Intergenic
1077065850 11:640638-640660 TCTCCTTGGTCCCTGAGGCCTGG - Exonic
1077201521 11:1309764-1309786 TCTCCTCGAGCCCTGCAGCCCGG + Intergenic
1077842562 11:5991400-5991422 TCTCCTTGTTAACAGTGGCCTGG - Intergenic
1077967868 11:7155214-7155236 TCTGCTTATGCTCTGTGGCCAGG + Intergenic
1080512409 11:32987983-32988005 TCACCTTGTGCTGTGTGGCCTGG - Intronic
1080615274 11:33940260-33940282 TCTCTCAGAGCACTGTGGTCAGG - Intergenic
1080992860 11:37560651-37560673 ACTCCTTGATCACTATGTCCGGG + Intergenic
1082205672 11:49431170-49431192 TCATCTTGACTACTGTGGCCTGG - Intergenic
1083405651 11:62455226-62455248 TTTCCTTAAGAAATGTGGCCGGG - Intronic
1085046559 11:73356946-73356968 TCCCCTTGGGCACTATGGGCAGG + Intronic
1085452914 11:76647697-76647719 TCTCCTAGAGTTCTGTGACCTGG + Intergenic
1085788880 11:79478608-79478630 TCTCCTTTAGCCCCCTGGCCTGG - Intergenic
1087672732 11:101127474-101127496 CCTCCTTGAGCACGGCGGCCTGG + Exonic
1089384447 11:118058729-118058751 TCTCCCAGAGCAGTTTGGCCTGG - Intergenic
1089390809 11:118100439-118100461 TCTACATGAGCACTGAGGCTCGG + Intronic
1092526200 12:9311721-9311743 TCTCCTACAGGCCTGTGGCCAGG + Intergenic
1092541079 12:9420069-9420091 TCTCCTACAGGCCTGTGGCCAGG - Intergenic
1094511966 12:31102417-31102439 TCTCCTACAGGCCTGTGGCCAGG + Exonic
1094622068 12:32089272-32089294 TCTGGTTGAGCAATGTGGACAGG - Intergenic
1096411022 12:51377225-51377247 TCTCCTTGAGCAAGATGGCAGGG + Exonic
1098020083 12:66145693-66145715 TCTCTTTGAGTACTAGGGCCAGG - Intronic
1098886611 12:75967230-75967252 TCTCCCTGAGTACTGAGTCCAGG - Intergenic
1101325646 12:103713280-103713302 TTCTCTTGAGCACTGTGTCCTGG + Intronic
1106168414 13:27269280-27269302 TCTCATTCAGCACGTTGGCCAGG - Intergenic
1107969634 13:45628820-45628842 TCTCTTTGCTCAGTGTGGCCAGG - Intergenic
1108486017 13:50925915-50925937 TCCCTTTCTGCACTGTGGCCTGG + Intronic
1110184224 13:72654715-72654737 TCTGCCCCAGCACTGTGGCCTGG - Intergenic
1112302134 13:98240063-98240085 TTTCCTTTAGCCCTGTGGACTGG + Intronic
1116686369 14:48044516-48044538 TCCCCTTGATCACTGTTTCCAGG - Intergenic
1118444652 14:65840207-65840229 TGTCCTTCAGCACCCTGGCCTGG - Intergenic
1118844327 14:69535364-69535386 TCTCCCTCCCCACTGTGGCCTGG + Intergenic
1121174709 14:91882514-91882536 TCTCCTAGAGCATGGTTGCCAGG - Intronic
1121312193 14:92941188-92941210 TCTCCATGGCCACTGTGGACCGG - Exonic
1122343898 14:101046169-101046191 TCTCCTGGTGCAGTGTGGGCGGG + Intergenic
1122784340 14:104156931-104156953 CCCCCTTGGGCACCGTGGCCTGG - Intronic
1123215504 14:106805625-106805647 TCCTCTTCAGCACTGTGGCCTGG + Intergenic
1126900312 15:53307992-53308014 TCTCCTGGAGCACTTTGGTCTGG + Intergenic
1128703559 15:69821837-69821859 GCTCCTTGAGGACAGGGGCCAGG + Intergenic
1128706208 15:69839058-69839080 CTTCCTGGAGCACTGTGGCTAGG - Intergenic
1132314842 15:100881927-100881949 TCTCCCTGAGGACTGTGCCAGGG - Intronic
1133255641 16:4514197-4514219 TCTCCTTCAGCCCTGTGGGGTGG + Intronic
1136559823 16:31032813-31032835 CCTCCTTGAACACTGCAGCCCGG - Intergenic
1137854774 16:51783414-51783436 TCTCCATGTCCACAGTGGCCAGG - Intergenic
1139433058 16:66921442-66921464 TCTCTTTCTGCACTGGGGCCTGG - Intergenic
1139475222 16:67199561-67199583 CCTCCTTCAGCACAGCGGCCAGG - Exonic
1141534337 16:84668710-84668732 TCTCCTTGTTCACTTTGGTCTGG + Intergenic
1141977260 16:87525146-87525168 TCTCCTAAGGCTCTGTGGCCAGG + Intergenic
1142738917 17:1919000-1919022 TCTTCCTGAGCTCTGTGGCATGG - Intergenic
1143413986 17:6732255-6732277 TCTCCTTGAGAACAGTGCCAAGG - Intergenic
1146578318 17:34013699-34013721 TACCCTTTAGCAATGTGGCCTGG - Intronic
1148505804 17:48126228-48126250 TCTCCTTGAGTAATGAGGGCTGG + Intergenic
1151106382 17:71621001-71621023 CCTCCTTGAACTCTGTGGTCTGG - Intergenic
1151576455 17:74954725-74954747 TCCCCTCGAGCAAGGTGGCCAGG + Intronic
1156864454 18:41873407-41873429 TCTCCCTGAGCAGAGTGACCAGG + Intergenic
1157999990 18:52607188-52607210 ACTCCATGACCACTGTGGCAGGG + Intronic
1158305456 18:56100461-56100483 TTTCCTTGAGCACTGCTGCGAGG + Intergenic
1160237751 18:77099343-77099365 TCTCATGGTGCAGTGTGGCCTGG - Intronic
1160939722 19:1614603-1614625 TCTCCTGCAGCACTGTTGCTGGG - Intronic
1161269762 19:3383361-3383383 TCTCCTTGTTCACTGTGGCCTGG - Intronic
1161634828 19:5381243-5381265 TCTCCTTCACCATTGTGTCCTGG - Intergenic
1161876310 19:6913730-6913752 TCTCCAGGAAGACTGTGGCCAGG - Exonic
1162838287 19:13336178-13336200 TCTCCTTCTGGACTGTGGTCTGG - Intronic
1163823953 19:19512491-19512513 TCGCCATGAGCTCTGGGGCCTGG + Intronic
1164570396 19:29370488-29370510 TCGCCTTGCACACTTTGGCCAGG + Intergenic
1164892521 19:31836974-31836996 TCTCCTTGAGCACCCCTGCCAGG + Intergenic
1165015904 19:32879828-32879850 TCTGCTTGTCCACTGTGACCTGG + Intronic
1165488184 19:36108050-36108072 TCTCTTTGTGCCTTGTGGCCTGG - Intergenic
1166777527 19:45322096-45322118 TGTCCTTGAGCCCCGAGGCCTGG - Intronic
1167492755 19:49801718-49801740 TCTCCTCCAGCACCGTGGCCTGG - Exonic
926038535 2:9654469-9654491 TCTCCTGGAGAACTGGGCCCTGG - Intergenic
926652794 2:15364570-15364592 TCTCCTGGAGCACTGACTCCAGG + Intronic
927383469 2:22505996-22506018 CCTCCATAAGCACTGTTGCCTGG + Intergenic
927653297 2:24925105-24925127 ACTCCTTGGGCACTGTGGATGGG + Intergenic
927719128 2:25372071-25372093 CCGCCTTGAGCACTGTAGACCGG + Intergenic
927997071 2:27494178-27494200 TCTGGTTGAGCCTTGTGGCCTGG - Intronic
928196375 2:29219424-29219446 TCCCTTTGAGCAGTGTGGTCAGG + Intronic
931214162 2:60226008-60226030 TGCCCTTGAGCAATGGGGCCGGG + Intergenic
931452718 2:62381824-62381846 TGTTCCTGAGCACTGTTGCCTGG - Intergenic
932080343 2:68708767-68708789 TGTCATTCAGCACTGTGCCCTGG + Intronic
932277059 2:70459566-70459588 TCTCCTTGCTCAGTGTGGCAAGG + Intronic
933840659 2:86283570-86283592 TTACCATGAGCACTGTTGCCAGG + Intronic
935884579 2:107602995-107603017 TCACCTTGTGCTGTGTGGCCTGG - Intergenic
938094937 2:128455541-128455563 TAGCCCTGACCACTGTGGCCTGG + Intergenic
940661639 2:156552836-156552858 TTTCCTTGGGCTGTGTGGCCTGG + Intronic
941446238 2:165603331-165603353 TTTCCTTGAGCACTCTGACCTGG + Intronic
942224690 2:173804935-173804957 TCACCTTCAACACAGTGGCCAGG + Intergenic
942450622 2:176106224-176106246 TCTCCTTCAGCACTGAAGCCAGG - Intronic
943463573 2:188199976-188199998 TTTCCTTGATCACTGTACCCTGG + Intergenic
946487254 2:220112800-220112822 TTTACTTGAGCACAGTGTCCCGG - Intergenic
947611672 2:231528564-231528586 TGACGTTGAGCACTGAGGCCAGG + Exonic
1169145618 20:3250310-3250332 GCTCTTTGAGGACTGAGGCCAGG - Exonic
1172230005 20:33330205-33330227 TCTCCAAGAGCCCTGTGGTCTGG - Intergenic
1173921792 20:46751599-46751621 CCTCCTTGAGCACTGGGGTAAGG + Intergenic
1174116298 20:48228844-48228866 TCTTCTGGAGCACTGGGGACTGG + Intergenic
1174641597 20:52049384-52049406 TCTCCTGTAGCACACTGGCCAGG - Intergenic
1174984996 20:55441444-55441466 TCTTCTTGTCCACTGTGGCCTGG + Intergenic
1175977751 20:62720532-62720554 TCTCCTTGGGCAATATGGCTAGG + Intronic
1175988520 20:62776299-62776321 TCTCCTTGCTCACAGTGGTCCGG + Intergenic
1176301729 21:5101851-5101873 TCCCCTTCAGCTCTGTGCCCAGG - Intergenic
1176987756 21:15456596-15456618 TCTCCTTGCTCCATGTGGCCGGG + Intergenic
1179281745 21:39939626-39939648 TCTCCTGGTGCTGTGTGGCCTGG + Intergenic
1179855302 21:44160048-44160070 TCCCCTTCAGCTCTGTGCCCAGG + Intergenic
1180725244 22:17942048-17942070 TTTCCTTGAGTGCTGTGGCTGGG - Intronic
1180997725 22:19973757-19973779 GCTCTTTGCGCACTGTGGCGCGG + Exonic
1181052818 22:20245796-20245818 GCTCCGTGAGAACTGGGGCCAGG - Intronic
1181491814 22:23264830-23264852 ATTCCTGGGGCACTGTGGCCTGG + Intronic
1184233360 22:43170167-43170189 TCTCCTGGAGCTCTGTGCCTGGG - Intronic
1184425033 22:44404227-44404249 TCTCCTCCAGCTGTGTGGCCAGG + Intergenic
1184659693 22:45960163-45960185 TCTCCTTGGCCACTTTGGCCAGG + Intronic
1185198622 22:49489073-49489095 TCGTCCTGAGCACTCTGGCCAGG + Intronic
950255807 3:11504570-11504592 TGTCCTAGAGCCCTCTGGCCTGG - Intronic
950360350 3:12445388-12445410 ACTCCTGGAGCACTGGGCCCAGG - Intergenic
952629888 3:35453512-35453534 TCTGCCTGAGCTCTGTGGGCAGG + Intergenic
953363918 3:42325477-42325499 TCTCCTCGCCCACTGTGGTCTGG + Intergenic
954284192 3:49607150-49607172 TCTCCCTTAGCACTGCTGCCTGG + Intronic
954540192 3:51388500-51388522 TCTCCATGACCACAGTGACCTGG - Intronic
959022021 3:101198108-101198130 TCTCCTTGTACACTGTTTCCAGG - Intergenic
963193246 3:142497115-142497137 TCTTCTTGAGAACTGTCACCTGG + Exonic
964851489 3:161101038-161101060 TCTCCTGGGGCACTGTGCCCTGG - Intronic
965568732 3:170149749-170149771 TATCCTTAAAAACTGTGGCCGGG - Intronic
965980546 3:174684910-174684932 TCTACTTTATCACAGTGGCCGGG - Intronic
966115879 3:176459709-176459731 TGTCAATGAGCACTTTGGCCTGG + Intergenic
968647765 4:1748909-1748931 CCTCCTGGAGGCCTGTGGCCAGG - Intergenic
969340051 4:6534991-6535013 CCTCCTTGTGGACTGTGGCAGGG - Intronic
969566033 4:7978758-7978780 TTTCCTTGAGTTCTGTGGTCAGG - Intronic
970395043 4:15656268-15656290 TCTCCAGGAGGTCTGTGGCCAGG - Intronic
971648866 4:29245560-29245582 TCTCTATGACCACAGTGGCCAGG + Intergenic
972249133 4:37280901-37280923 TCTCCTTTCTCCCTGTGGCCTGG + Intronic
973051682 4:45606951-45606973 TCTCCTTAAGCTTTCTGGCCGGG - Intergenic
975220307 4:71806372-71806394 TCTTCTTCAGCACCGTGTCCAGG + Intergenic
976621703 4:87134858-87134880 GTTCCTTGAGCACTGTGGCATGG + Intronic
977394527 4:96454535-96454557 TCTCCCTGAACTCTGTGGGCAGG - Intergenic
978153441 4:105463926-105463948 TCTGCTAGAGCACTGTGGAAGGG + Intronic
978178763 4:105767702-105767724 TCTCCTTCAGCCCTGTAGCCTGG + Intronic
978582742 4:110248404-110248426 TCTGCCTGAGCAATGGGGCCAGG + Intergenic
982205434 4:152994316-152994338 GCTCCTTAAGCTTTGTGGCCTGG - Intergenic
982568363 4:157016197-157016219 TATCCTTTAGCACTGTCACCTGG + Intergenic
985572058 5:652179-652201 TCTCCTTGAGCACTGTGGCCTGG + Intronic
986512324 5:8521028-8521050 TCTCCTTGAGCACAGAGAGCCGG + Intergenic
987696012 5:21333256-21333278 TCTCCTTCACCACTGTGGACTGG - Intergenic
988446977 5:31297884-31297906 TTTCCATGATCACTGTGGCAAGG - Intronic
988756189 5:34253355-34253377 TCTCCTTCACCGCTGTGGACTGG + Intergenic
991625214 5:68594091-68594113 TCTCCTCCTGCTCTGTGGCCTGG - Intergenic
991744385 5:69718841-69718863 TCTCCTTCACCGCTGTGGACTGG + Intergenic
991753320 5:69836392-69836414 TCTCCTTCACCGCTGTGGACTGG - Intergenic
991795957 5:70298565-70298587 TCTCCTTCACCGCTGTGGACTGG + Intergenic
991802937 5:70393119-70393141 TCTCCTTCACCGCTGTGGACTGG - Intergenic
991823766 5:70594155-70594177 TCTCCTTCACCGCTGTGGACTGG + Intergenic
991832640 5:70711511-70711533 TCTCCTTCACCGCTGTGGACTGG - Intergenic
991888334 5:71298125-71298147 TCTCCTTCACCGCTGTGGACTGG + Intergenic
999086731 5:148898710-148898732 TCTCTTTGAGAAATGTGGTCTGG + Intergenic
999609101 5:153350256-153350278 ACTCCCTGAGCCCTGTGGCTTGG - Intergenic
1001055865 5:168449435-168449457 TCTCTTTGAGCACTGTTGTGAGG + Intronic
1002469006 5:179423572-179423594 TCTGCTTCTGCACTGTGGGCAGG - Intergenic
1003137453 6:3444683-3444705 TCTCTCTGAGCCCTGTGGCCCGG + Intronic
1004852277 6:19712414-19712436 TCACCTTCTGCTCTGTGGCCTGG - Intergenic
1005554774 6:26964799-26964821 TCTCCTTCACCGCTGTGGACTGG + Intergenic
1006938836 6:37737996-37738018 TCTCCCTGAGCCCTGTGCCCAGG - Intergenic
1007264466 6:40586499-40586521 ACTCCCTGAGCTCTGTGGACTGG - Intronic
1007322191 6:41035385-41035407 TCACCTTGGTCACTGTGGCTGGG + Intronic
1008038511 6:46772752-46772774 TCTCTTTGGGCACTCTGGCATGG + Intergenic
1013373473 6:109490954-109490976 CCTCAGTGAGCACCGTGGCCTGG + Intergenic
1015809320 6:137145979-137146001 TCTCCTTGAGGGCTGTTGGCTGG + Intronic
1017525719 6:155240022-155240044 ACTCCTGGCCCACTGTGGCCAGG + Intronic
1019133173 6:169892073-169892095 TCACCGTGAGCATTGTGGACAGG + Intergenic
1019215893 6:170443588-170443610 TCCCCCTGGGCCCTGTGGCCTGG + Intergenic
1020717278 7:11690633-11690655 TCACCTTGAGCCCTTTGGCGGGG + Intronic
1021768325 7:23971340-23971362 TCTCCTCGAGCCCTGTAGTCAGG + Intergenic
1022662897 7:32382853-32382875 ACTCCTTGCTCACTGTCGCCAGG + Intergenic
1023984001 7:45084925-45084947 TGTCCTGGAGCAAAGTGGCCTGG + Exonic
1024113233 7:46168562-46168584 TCTCTTCCAGCACTGTGGCTCGG + Intergenic
1024200599 7:47102573-47102595 TCTCCTGCAGCTCCGTGGCCTGG + Intergenic
1024738914 7:52334855-52334877 TTGCCTTGAGCAATGGGGCCTGG + Intergenic
1028699794 7:93764089-93764111 TCTCCTTGAGAACTGGAACCAGG + Intronic
1029109105 7:98203186-98203208 TCTCCTGGAGCACTGTGTCCAGG + Intronic
1029653027 7:101906609-101906631 TGTCCTGGAGGACTGTGTCCTGG + Intronic
1032067598 7:128783310-128783332 CCTGCTGGAGCACAGTGGCCTGG + Intergenic
1033156306 7:138960060-138960082 TCTCCTGGACCTCAGTGGCCCGG - Intronic
1033940402 7:146645434-146645456 TCTCCACTGGCACTGTGGCCAGG - Intronic
1036637943 8:10564445-10564467 TCACTTTCAGCATTGTGGCCTGG + Intergenic
1037155783 8:15696459-15696481 TCTGCTAGAGCACTGTGGAAGGG + Intronic
1039655716 8:39403465-39403487 TCACCTTGTGCTTTGTGGCCTGG + Intergenic
1040417539 8:47208447-47208469 TCTCCTTGAGCTCTGGGAACTGG - Intergenic
1045354304 8:101371821-101371843 TCTCCTTGAGGGCTGGGGCCAGG - Intergenic
1045507584 8:102789394-102789416 TCTCTTTGAGCAATGTCTCCCGG - Intergenic
1047481811 8:125290670-125290692 TCTCCTTGATCACAGTTGCCTGG - Intronic
1048959114 8:139561371-139561393 TCTTCTTCAGCCCTGTGACCTGG - Intergenic
1049185953 8:141253651-141253673 CCTCGTTGTTCACTGTGGCCTGG + Intronic
1049917330 9:330886-330908 TCTCCTTGCCCACTGCAGCCAGG + Intronic
1049959536 9:725179-725201 TCTCGTTCAGCTCTGTGGCCTGG + Intronic
1050159351 9:2701028-2701050 TCTCCTTGAGGAGTGGGCCCAGG + Intergenic
1050306171 9:4308131-4308153 TCTCCAGGAGCATTGTGGCTTGG + Intronic
1050428885 9:5541349-5541371 TCTCTTTGAGTGCTCTGGCCAGG - Intronic
1051450619 9:17193543-17193565 CCTCTTTGATCACTGTGACCTGG - Intronic
1055379289 9:75688732-75688754 TCTGCTCCAGGACTGTGGCCAGG - Intergenic
1057184941 9:93052195-93052217 TCACCCTCATCACTGTGGCCAGG - Intergenic
1057440455 9:95079166-95079188 TCTCAGAGGGCACTGTGGCCTGG + Intronic
1058141870 9:101365160-101365182 TCTCCTTGAGCACTGGCTCCTGG + Intronic
1061919958 9:133777346-133777368 GCTTCTGGAGCACGGTGGCCTGG - Intronic
1062120026 9:134829420-134829442 TCTCCCTGAGGGCTGGGGCCAGG + Intronic
1187277512 X:17828801-17828823 TGTCCCTGAGCTCTGTGGCCTGG + Intronic
1187318119 X:18217028-18217050 TATCATTGAACACTGTGGCATGG - Intronic
1187643244 X:21318196-21318218 TTTCCTTGAGCTCTCTGGGCTGG - Intergenic
1190053733 X:47170290-47170312 TCTCCAGGAGCACTGGGCCCTGG + Intronic
1190310267 X:49112380-49112402 TCTGCTTTAGCATTGTGGCACGG + Intergenic
1191662642 X:63666956-63666978 GCTCCTTGAGGACAGGGGCCAGG - Intronic
1192557578 X:72102803-72102825 TTTCCTGGAGCATTTTGGCCTGG + Intergenic
1192920015 X:75696632-75696654 TCTGCTAGAGCAGTGTGGACGGG - Intergenic
1192924535 X:75741537-75741559 GCTCCTTCTGCACTGTTGCCAGG - Intergenic
1193671816 X:84396774-84396796 TCTCCTTGAGCACTCCTCCCAGG - Intronic
1195976927 X:110536805-110536827 TCTTCTTGAGAACTGTGGGTGGG - Intergenic
1197040437 X:121929994-121930016 TCTCCTAGAGCAGTGTGGAAGGG + Intergenic
1202067358 Y:20953755-20953777 TATCCTTGATCTCTGTGGCCAGG - Intergenic