ID: 985572060

View in Genome Browser
Species Human (GRCh38)
Location 5:652185-652207
Sequence TGAGCACTGTGGCCTGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985572049_985572060 29 Left 985572049 5:652133-652155 CCTGGTGGGCCTGTCTGTGGCAG 0: 1
1: 1
2: 4
3: 27
4: 286
Right 985572060 5:652185-652207 TGAGCACTGTGGCCTGGATGTGG 0: 1
1: 0
2: 1
3: 35
4: 314
985572052_985572060 20 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572060 5:652185-652207 TGAGCACTGTGGCCTGGATGTGG 0: 1
1: 0
2: 1
3: 35
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985572060 Original CRISPR TGAGCACTGTGGCCTGGATG TGG Intronic
900655022 1:3752567-3752589 TGAGCTTTGTTGCCTGAATGTGG - Exonic
901203096 1:7477744-7477766 TGAGCAATGGGGCCTGCAAGGGG - Intronic
901284235 1:8063958-8063980 TCAGCACTGTGACCAGGATGGGG + Intergenic
901959075 1:12810312-12810334 AAAGGACTGGGGCCTGGATGTGG - Intergenic
902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG + Intergenic
902863119 1:19260052-19260074 AGAACAATGTGGGCTGGATGCGG - Exonic
903384953 1:22920216-22920238 TGGGCACTGTGGCCTGTGTGGGG - Intergenic
905391820 1:37640804-37640826 TGAGAACTGTGGCAAGGAAGGGG - Intergenic
905467034 1:38162880-38162902 TCAGAGCTCTGGCCTGGATGGGG + Intergenic
906156810 1:43618791-43618813 TAAGGACAGTGGCCTGGGTGTGG + Intronic
906791387 1:48661278-48661300 TGAGCCCTGTGAGATGGATGGGG + Intronic
909977326 1:82060345-82060367 TGAGGACTGTGGCCAGGTGGGGG - Intergenic
915971592 1:160358819-160358841 TGAGCACTGTGGGCTGGAGGTGG - Exonic
916717236 1:167455866-167455888 TGGGCACAGTGGCCAGGATCGGG + Intronic
919254561 1:195104963-195104985 GAATCACTGTGCCCTGGATGTGG - Intergenic
920292671 1:204934873-204934895 TGGGCACTGTGGACGGGAGGAGG + Intronic
920736170 1:208534708-208534730 TGAGCACACTGGCATGCATGAGG - Intergenic
921465023 1:215477262-215477284 TAACCAGTGTGCCCTGGATGTGG - Intergenic
922143824 1:222918157-222918179 ACAGAATTGTGGCCTGGATGGGG - Intronic
923419505 1:233798720-233798742 TGTCCATTCTGGCCTGGATGGGG - Intergenic
924284407 1:242470998-242471020 GAACCACTGTGGCCTGGAAGGGG - Intronic
1063086551 10:2823303-2823325 TGAGATCTGTGGCAAGGATGGGG + Intergenic
1063367232 10:5498842-5498864 TGCGCTCCGGGGCCTGGATGCGG - Exonic
1063722794 10:8601404-8601426 TGTGCACTATGGCTTGGATGTGG + Intergenic
1066757039 10:38721696-38721718 AGAGCACAGTAGGCTGGATGTGG - Intergenic
1069641726 10:69960781-69960803 GGAGGAGTGTGGCCTGGAGGTGG - Intronic
1069916975 10:71793213-71793235 TGAGGACAGTGGCCTCAATGGGG + Intronic
1070055720 10:72932705-72932727 TGAACAATGTGGCCTGGGTGGGG + Exonic
1071289188 10:84176397-84176419 TGAGCCCTGTGCCTTGGAAGGGG + Intronic
1073146799 10:101286362-101286384 TGAAGACCGTGGGCTGGATGAGG - Intergenic
1073462285 10:103672857-103672879 TGAGCACTATGGGCTGTGTGAGG - Intronic
1074118715 10:110477309-110477331 GGACCACTGTGGCCTGTCTGAGG - Intergenic
1074717398 10:116232798-116232820 TAAGCACTGTTGCCAGGCTGAGG + Intronic
1074923610 10:118046103-118046125 GGAGCACTGTGACCTGCACGTGG + Exonic
1075060660 10:119254614-119254636 TCAGCTCTGTGGCCTGGGTCAGG + Intronic
1076488076 10:130837009-130837031 AGAGCAGTGTGGCCTGGAGATGG + Intergenic
1076784640 10:132743702-132743724 TGACCGCTGTGGGCTGGCTGGGG - Intronic
1077131825 11:976836-976858 TGAGCAATGTGAGCTGCATGTGG + Intronic
1077497059 11:2891505-2891527 TGAACGCTGTGGCTTGGGTGTGG - Intronic
1077754853 11:5015797-5015819 TCAACACTGTGCCCAGGATGAGG - Intergenic
1078099802 11:8323350-8323372 AGAGAGCTGTGCCCTGGATGTGG + Intergenic
1078103472 11:8343822-8343844 TGAGAGCTGAGGCCAGGATGAGG - Intergenic
1078848441 11:15142311-15142333 GGAGCACTCTGGCCTGGTGGTGG - Intronic
1080136139 11:28857324-28857346 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
1080946252 11:36978659-36978681 GCATCACTGTGCCCTGGATGTGG - Intergenic
1081787358 11:45756833-45756855 TTGGGACTTTGGCCTGGATGTGG - Intergenic
1082249344 11:49961776-49961798 ACAACACTGTGCCCTGGATGTGG + Intergenic
1083609768 11:63999278-63999300 TGGTCACTCTGGCCGGGATGCGG + Intronic
1083799572 11:65038711-65038733 TGAGCTCTGTGGCCTGGCTTAGG - Exonic
1083968478 11:66057683-66057705 AGGGCACTGTGGGCTGGGTGCGG + Intronic
1084019823 11:66410776-66410798 TGAGCATTTTGGCCAGGCTGTGG + Intergenic
1084776661 11:71381148-71381170 TGTGGTCTGTGGCCTGCATGTGG + Intergenic
1084968711 11:72757809-72757831 TGGGCCCTGTGCTCTGGATGAGG + Exonic
1085244479 11:75089020-75089042 GAAGCACTGAGGCCAGGATGTGG + Exonic
1085371769 11:76013916-76013938 GGAGCACTATGGCCTGGAATGGG + Intronic
1086004112 11:82015722-82015744 AGAGCACAGAGGCCTGGAAGAGG + Intergenic
1086114059 11:83228816-83228838 TGAGCTCTGTGCCCTCGATTTGG + Intronic
1086989674 11:93289196-93289218 TGTTTCCTGTGGCCTGGATGTGG - Intergenic
1087169990 11:95040800-95040822 TGAGCACGGTGGGCACGATGAGG - Intergenic
1088567193 11:111184479-111184501 GCAGCAGTGTGCCCTGGATGTGG + Intergenic
1088817508 11:113431908-113431930 TGAGCAGGGTGGCCTGCCTGGGG - Intronic
1088882436 11:113982508-113982530 TGACCACTGTGGCATGGAGTAGG - Intronic
1089496722 11:118911817-118911839 TGGGCACTGTGGCTGGAATGTGG - Intronic
1090149660 11:124369481-124369503 TGAGGACAGTGGAATGGATGAGG - Intergenic
1090834138 11:130441575-130441597 TGTGCACTATGGCATGGATAGGG - Intergenic
1092089082 12:5789354-5789376 TGAGCATTTTAGTCTGGATGAGG - Intronic
1092266929 12:6988720-6988742 TGAGCACTGCGGCCTGCATTCGG - Intronic
1093690323 12:22102288-22102310 TGAGGACTGGGACCTGTATGGGG + Intronic
1097278779 12:57831538-57831560 TGGTCACTGTGGCCAGGAGGTGG + Intronic
1098112029 12:67133124-67133146 TGACCACTGTGCCCTGCAAGAGG - Intergenic
1099960378 12:89391459-89391481 TGGGCAGAGTGGCCTGGAGGTGG - Intergenic
1100961567 12:99968265-99968287 TGAGGGCTGTGGGCTGGGTGTGG + Intronic
1102981773 12:117247380-117247402 TGAGCTCTGTGGGCAGGAAGAGG - Exonic
1103328020 12:120134494-120134516 GGAGCACTGTGGCCTCCAGGAGG - Intronic
1104355292 12:128079805-128079827 TCAGCGCTGTGTTCTGGATGTGG + Intergenic
1104780987 12:131420476-131420498 TGAGCCATGGGGCCTGGATGGGG - Intergenic
1106788784 13:33133231-33133253 TGGGCACTGTGGCCTGGGAAGGG + Intronic
1109252109 13:60032075-60032097 GTACCAATGTGGCCTGGATGTGG - Intronic
1110064412 13:71085811-71085833 TAAGCACTGTGGGCTGGTTCAGG + Intergenic
1110620762 13:77592853-77592875 TAAGAACTGTGGGCTGGGTGTGG - Intronic
1111217433 13:85162990-85163012 TCACCAGTGTGTCCTGGATGTGG - Intergenic
1111277289 13:85966868-85966890 TGGGCACTGGTGTCTGGATGAGG + Intergenic
1112363599 13:98739000-98739022 GGATCAATGTGCCCTGGATGTGG + Intronic
1112674950 13:101690532-101690554 TCAGCAGTGTGGTCTGGATATGG - Intronic
1113844187 13:113376447-113376469 AGAGGACAGTGGCCTGGAGGAGG + Intergenic
1114543910 14:23484338-23484360 AGGGCACTGTGGGCTGAATGGGG - Intronic
1118811796 14:69280696-69280718 TGAACATTGTTGCCTGGATGAGG + Intronic
1118869002 14:69726223-69726245 TGTGGACTGTGACCAGGATGCGG + Intergenic
1121104522 14:91271819-91271841 TGTGCACACTGGCCTGGAGGGGG + Exonic
1121140673 14:91539042-91539064 GCATCAGTGTGGCCTGGATGTGG - Intergenic
1122339620 14:101019739-101019761 TGTGCAGTGTGGACTGGATGGGG - Intergenic
1122400880 14:101466643-101466665 TGACCACCTTGGCCTGGCTGGGG - Intergenic
1122605872 14:102947429-102947451 TGAGGACAGTGGCCGGGACGTGG + Intronic
1122847986 14:104511146-104511168 CGGGCACCGTGGCCTGGCTGGGG - Intronic
1125740007 15:41955940-41955962 TACGCCCTGTGGCCTGGATGGGG + Intronic
1125883402 15:43211587-43211609 GGAGGACAGAGGCCTGGATGTGG - Intronic
1128371120 15:67040088-67040110 TGAGCACTGTGGCCAGCGTGGGG - Intergenic
1129238241 15:74236527-74236549 CCAGCCCTGGGGCCTGGATGTGG - Exonic
1129514485 15:76148670-76148692 TGGCCACTGTGCCCTGGGTGGGG + Intronic
1129524299 15:76204225-76204247 TGGGCACAGTGGGCTGGAAGTGG - Exonic
1130083391 15:80755558-80755580 TGTGTACTGTTGCTTGGATGCGG + Exonic
1130920422 15:88339436-88339458 TGAGCACAGTGGGAGGGATGGGG + Intergenic
1132299381 15:100766866-100766888 TAAGCAGTGAAGCCTGGATGGGG - Intergenic
1132716791 16:1294519-1294541 TGAGGTCTGTGACCTGGATCAGG - Intergenic
1133678930 16:8101905-8101927 AAAGCATTGTGGGCTGGATGTGG - Intergenic
1136378017 16:29876855-29876877 TGAGCACCGTGCCCCGGATCAGG + Exonic
1136417382 16:30112412-30112434 TGAGCAAAGTGGCCTGGGGGTGG + Exonic
1136687272 16:32002843-32002865 TGAGCACAGGGGCCTGGGAGTGG + Intergenic
1136720483 16:32316034-32316056 AGAGCACTGTAGGCTGGATGTGG + Intergenic
1136725543 16:32354427-32354449 AGAGCACTGTAGGCTGGATGTGG + Intergenic
1136787887 16:32946394-32946416 TGAGCACAGGGGCCTGGGAGTGG + Intergenic
1136838862 16:33522310-33522332 AGAGCACTGTAGGCTGGATGTGG + Intergenic
1136843872 16:33560483-33560505 AGAACACTGTAGGCTGGATGTGG + Intergenic
1136881897 16:33907395-33907417 TGAGCACAGGGGCCTGGGAGTGG - Intergenic
1140151502 16:72372033-72372055 TGGGGATTGTGGCCTGGATTAGG + Intergenic
1140344126 16:74195703-74195725 TGAGAGCTGTGGACTGGGTGTGG - Intergenic
1140902781 16:79384965-79384987 TGAACAATGTGGTCTGGCTGTGG + Intergenic
1141349556 16:83281365-83281387 AGAGCACTTTGGTCTGGATTAGG + Intronic
1141948531 16:87325851-87325873 TGGGCACTGTGTCCTGTCTGAGG + Intronic
1142194364 16:88732758-88732780 GGGGCACTGTGGCCTGGGAGGGG - Intronic
1142231168 16:88900959-88900981 TGAGCACGGGGGCCAGGGTGGGG - Intronic
1142287886 16:89178869-89178891 TGGGCACAGTGGGCTGGCTGTGG - Intronic
1142356591 16:89604393-89604415 GGAGCACTGAGGCCTGGAGGGGG + Intergenic
1203000889 16_KI270728v1_random:163329-163351 AGAGCACTGTAGGCTGGATGTGG - Intergenic
1203005949 16_KI270728v1_random:201735-201757 AGAGCACTGTAGGCTGGATGTGG - Intergenic
1203090114 16_KI270728v1_random:1208051-1208073 TGAGCACAGGGGCCTGGGAGTGG + Intergenic
1203132490 16_KI270728v1_random:1699732-1699754 AGAGCACTGTAGGCTGGATGTGG - Intergenic
1203149027 16_KI270728v1_random:1822598-1822620 AGAGCACTGTAGGCTGGATGTGG + Intergenic
1203154037 16_KI270728v1_random:1860781-1860803 AGAACACTGTAGGCTGGATGTGG + Intergenic
1143323456 17:6082775-6082797 GGAGCACTGGGGCCTGGGTTAGG + Intronic
1143376499 17:6470530-6470552 GGAGCACCCTGGCCTGGAGGAGG + Intronic
1143855239 17:9843382-9843404 TGATCCCTGTGGCATGAATGAGG - Intronic
1144100326 17:11937231-11937253 TGAGCAGTGTCCCCTGGAGGAGG + Intronic
1144236309 17:13263568-13263590 TGAGCCCTGCGGCCTTGATTTGG - Intergenic
1144324931 17:14169765-14169787 TGAACACTTTGGTTTGGATGTGG + Intronic
1146688680 17:34858155-34858177 TGAGGACTGGGGACAGGATGGGG - Intergenic
1146794581 17:35772434-35772456 TCAGCAGTAGGGCCTGGATGTGG + Intronic
1146890521 17:36503616-36503638 TGAGAAGTGTTGCCTTGATGAGG - Intronic
1148186275 17:45646539-45646561 TGAGCACTGGGCCCCGGGTGCGG + Intergenic
1149684890 17:58529580-58529602 AGGACACTGTGGCCTGTATGAGG + Intronic
1150317106 17:64178262-64178284 TGTGCACTCTGGCCTGGAGGGGG + Intronic
1150674509 17:67233434-67233456 TGAGCACTGCTGCCTGGGTGAGG + Intronic
1151030635 17:70733937-70733959 TGCTCACTGAGGCCTGGAAGTGG - Intergenic
1151213412 17:72561352-72561374 TGGCCACTGTGGCCAGAATGAGG - Intergenic
1151338105 17:73452182-73452204 TGAGCACCGGGGCATGCATGAGG + Intronic
1151350244 17:73527588-73527610 AGAGCCCTGGAGCCTGGATGTGG - Intronic
1152281148 17:79385500-79385522 TGATCACTGTGGCCAGGAACAGG - Intronic
1152428949 17:80236801-80236823 TGAGGACTGTGGCCCGGTGGGGG + Intronic
1152738709 17:82009622-82009644 TGAGGTCTGTGGACGGGATGGGG + Intronic
1154426231 18:14274214-14274236 ACACCACTGTGCCCTGGATGTGG + Intergenic
1155063940 18:22253019-22253041 TGGGCACTGTGCCCTGCCTGAGG - Intergenic
1156736307 18:40263578-40263600 TCAGCAGTGTGCCCTAGATGTGG + Intergenic
1157122800 18:44927329-44927351 TGAGCACTGGCGCCTGTCTGTGG - Intronic
1157234750 18:45953843-45953865 TGATCACTTTGGCCTCCATGGGG - Intronic
1157927328 18:51780568-51780590 TGTCCTCTGTGGCATGGATGTGG + Intergenic
1158374533 18:56848161-56848183 TGCACAGTGTGTCCTGGATGTGG + Intronic
1158454407 18:57593650-57593672 TGAGTACTGAGTCCTGGAGGTGG + Intergenic
1159086785 18:63801631-63801653 TGAGCACTGTTGATTGGGTGGGG + Intronic
1159759604 18:72408276-72408298 CCAGCAGTGTGCCCTGGATGTGG + Intergenic
1160319811 18:77879885-77879907 TGAGCACCGTGGCCACGGTGTGG - Intergenic
1160420260 18:78739110-78739132 TGTGCTCTGTGGGCTGCATGTGG - Intergenic
1160844658 19:1161080-1161102 TGAGCACTGGAGGCTGGAGGTGG + Intronic
1161056263 19:2191993-2192015 TCAGCCCTGCAGCCTGGATGGGG - Intronic
1161374641 19:3933289-3933311 TGAGCTCTCTGGCCAGGAGGAGG + Intronic
1162804300 19:13129052-13129074 AGGGCACTGTGGCCGGGGTGGGG + Intronic
1162922600 19:13912440-13912462 TGAGCACTGAGGGCGGGGTGGGG + Intronic
1164875941 19:31689039-31689061 TGAGCACTGTGGCCAGCAAAGGG - Intergenic
1165422606 19:35729809-35729831 TGTGCACCTGGGCCTGGATGCGG + Intronic
1165705355 19:37972410-37972432 TAAGAACTGTGGGCTGGGTGTGG + Intronic
1165771592 19:38383654-38383676 GCAGCACTGTGGCCTGCAGGAGG + Exonic
1166095725 19:40537820-40537842 TTAGCACAGTGCCCAGGATGTGG + Intronic
1166343069 19:42150270-42150292 GGAGCACAGAGGCCTAGATGGGG + Intronic
1166956963 19:46471234-46471256 TGAGCACCGGGGCCTGGGTTGGG - Intronic
1167110372 19:47457189-47457211 TCAGCCGCGTGGCCTGGATGCGG + Exonic
1167761493 19:51452664-51452686 AGAGCAGTGGGGCCAGGATGAGG + Intronic
925025414 2:603215-603237 TGAGCAATGCGACCTGGCTGTGG + Intergenic
925159115 2:1670853-1670875 TGGGCACTGTTCCCTGGGTGGGG - Intronic
925360202 2:3273829-3273851 TGAAGACAGTGGCCTGAATGAGG + Intronic
925455805 2:4015703-4015725 TCAGCAAGGAGGCCTGGATGTGG + Intergenic
925734021 2:6944479-6944501 GGGGCACTGTGGCCCAGATGTGG + Intronic
925910306 2:8569512-8569534 TGATGGCTGTGGCCTGGCTGTGG - Intergenic
927149640 2:20188267-20188289 AGAGCAATGCTGCCTGGATGAGG + Intergenic
927961664 2:27244108-27244130 TGAGCACTGCGGCCTGTCTGAGG + Intergenic
928102684 2:28448758-28448780 TGACTGCTGTGGCCTGGAGGAGG + Intergenic
928494683 2:31819946-31819968 GAACCACTGTGACCTGGATGTGG - Intergenic
929779134 2:44946531-44946553 TGAGGACAGTGGCCTGAGTGGGG + Intergenic
930027839 2:47040213-47040235 TGTGCCACGTGGCCTGGATGGGG + Intronic
932423716 2:71615917-71615939 TGTTCACTGTGTCCTGGCTGTGG + Intronic
932497476 2:72153552-72153574 TGAGGACTGGGCACTGGATGGGG - Intergenic
933463170 2:82615179-82615201 TGAGTATTGCGCCCTGGATGAGG + Intergenic
933750695 2:85600747-85600769 TTAGCTGTGTGACCTGGATGAGG + Intronic
934320345 2:91966137-91966159 GGAGCACAGTAGGCTGGATGTGG - Intergenic
934492771 2:94773064-94773086 TCACCACTGTGCTCTGGATGTGG - Intergenic
934888009 2:98041388-98041410 TCAGCAGTGTGGCCTTAATGTGG + Intergenic
935931610 2:108133002-108133024 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
936062724 2:109306243-109306265 TCAGCAGTGGGGCCGGGATGAGG + Intronic
936470099 2:112791322-112791344 AGAGCAGAGTGGCCTGGATGCGG - Intergenic
937002874 2:118484275-118484297 TGCACAGTGTGGCCTGGAAGTGG - Intergenic
937462724 2:122103342-122103364 ACAGCAGTGTGTCCTGGATGTGG - Intergenic
937474294 2:122201373-122201395 TGAGCAGTGTGGCCAGGACATGG - Intergenic
937681333 2:124647897-124647919 TGAGCACTGTGAGCAGGAGGTGG + Exonic
937981187 2:127616745-127616767 GCAGAGCTGTGGCCTGGATGGGG + Intronic
938435333 2:131280004-131280026 TCAGCCCTGTGCCATGGATGTGG + Intronic
940872223 2:158869567-158869589 GGAGCACTGATGCCTGGAAGGGG - Intergenic
942077867 2:172373513-172373535 TGAGCACTGCTGCCTGGAGGGGG - Intergenic
942753294 2:179312570-179312592 TGAGCCCTCTGGCCTGAATTCGG + Intergenic
945858617 2:215095410-215095432 TGATTGATGTGGCCTGGATGCGG - Intronic
946055777 2:216900837-216900859 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
946682434 2:222231089-222231111 TGAGCTCTGCAGCCTGGAAGAGG + Intronic
947527938 2:230890811-230890833 GGAGCCCTGTGGACTGGGTGGGG - Intergenic
948238427 2:236408309-236408331 TGCGCAAGGTGGCCTGGATTGGG - Intronic
948603217 2:239119287-239119309 TGAGGACAATGCCCTGGATGAGG + Intronic
948870622 2:240796108-240796130 TGAGCACTGTGGCCCGGGGTGGG - Intronic
1170565787 20:17603524-17603546 TTAGCAGTGTGGCATGGAGGTGG + Intronic
1170647006 20:18206733-18206755 TGAGCACTGGGGGTTGGTTGAGG - Intergenic
1170719159 20:18859990-18860012 TGCACAGTGTGACCTGGATGTGG + Intergenic
1172152014 20:32797308-32797330 TGGGCCCTGTGGGGTGGATGTGG + Intronic
1172760046 20:37315269-37315291 TGAAGTCTGTGGCCTGGACGAGG + Intronic
1172883442 20:38216406-38216428 TGATCGCTGTGGCCTGCACGTGG + Intronic
1172973357 20:38889108-38889130 TCAGCACAGTGGCCAGCATGTGG - Intronic
1172991174 20:39038155-39038177 TGAGCACAGTTGTCTGGCTGCGG + Intronic
1174823580 20:53748346-53748368 TGTGCTCTCTGGCCTGTATGAGG + Intergenic
1175552971 20:59828894-59828916 TGAGGCTTGTGGCCTGGATCAGG + Intronic
1176157344 20:63628147-63628169 TGAGCCCTGGGGGCTGGAGGAGG - Intergenic
1176926634 21:14758143-14758165 TGAGCACTTGGAGCTGGATGAGG + Intergenic
1177206650 21:18017927-18017949 GCACCACTGTGCCCTGGATGTGG + Intronic
1178618595 21:34154902-34154924 TGAGCACTGTTGCGTGCTTGTGG + Intergenic
1178845269 21:36169417-36169439 TGTGCAAGGTGGCCTGGATTGGG - Intronic
1179174348 21:38996512-38996534 TGTGGACTGTGGCATGGATAAGG - Intergenic
1180045150 21:45301776-45301798 AGTGCCCTGTGGCCTGGGTGTGG - Intergenic
1180308591 22:11150193-11150215 AGAGCACTGTAGGCTGGATGTGG - Intergenic
1180547068 22:16512004-16512026 AGAGCACTGTAGGCTGGATGTGG - Intergenic
1180938695 22:19642626-19642648 TGATCACTGTGGCTTGGTGGGGG - Intergenic
1183301136 22:37059705-37059727 TGGGCACTGTGGCATGGACTAGG + Intronic
1184016974 22:41793639-41793661 TAAGCACTGTGCTCTGTATGAGG + Intronic
1184503122 22:44885793-44885815 TGAGCCCAGAGGCCTGGGTGGGG + Intronic
1184525984 22:45023112-45023134 TGATCACTGTGGCTTGGAAAAGG - Intergenic
1184759212 22:46535445-46535467 CCAGCACCGTGGCCTGGAAGGGG + Exonic
1185048201 22:48539754-48539776 TGAGCCCTGTGGCCTTCCTGCGG - Intronic
949879205 3:8648669-8648691 GGGGCACTGTGGCCTGGAGGAGG - Intronic
950186197 3:10947153-10947175 GGAGCTCTGTGGCCCGGAGGAGG - Intergenic
950475126 3:13210207-13210229 TGGGCTGTGTGGCCTGGCTGTGG + Intergenic
951554244 3:23904544-23904566 TAAGCACTGTGGCCTATAAGAGG - Intronic
952276519 3:31882575-31882597 TGAGAAATGTGTTCTGGATGTGG - Intronic
953381723 3:42477404-42477426 GGAGCTCTGTAGGCTGGATGGGG - Intergenic
954794840 3:53156329-53156351 TGAGGACTGGGGGCTGGATATGG - Intronic
955036164 3:55270160-55270182 TAAGCACCCTGGCCTGGATCTGG - Intergenic
955549639 3:60070117-60070139 TGAGCCCTGTGACTTGGATGTGG - Intronic
957391105 3:79570891-79570913 TGAGTACTCTGGCCTGGAGCAGG + Intronic
957576541 3:82015170-82015192 GTACCACTGTGCCCTGGATGTGG + Intergenic
960033926 3:113084114-113084136 AGAACACCTTGGCCTGGATGTGG + Intergenic
961444675 3:126973678-126973700 TGAGCTCTGAGGCCTGGAGAAGG + Intergenic
961497290 3:127304154-127304176 TGTGCACTGTGCCCGGGAGGGGG - Intergenic
961741399 3:129035367-129035389 TGGGCACACTGGCGTGGATGCGG - Intronic
961749535 3:129087212-129087234 TGAGCACACAGGCCTGGATGAGG - Intergenic
962375288 3:134853887-134853909 TGGGCTCTCTGTCCTGGATGAGG - Intronic
965869867 3:173252710-173252732 GCATCAGTGTGGCCTGGATGTGG - Intergenic
968433075 4:570261-570283 AGGGCATTGTGGCCTGGCTGTGG - Intergenic
968742838 4:2340030-2340052 TCATCCCTGTGGCCTGGACGGGG - Intronic
969110546 4:4841459-4841481 TGAGCACAGAGGCCAGGAAGTGG - Intergenic
969327356 4:6451739-6451761 AGAGCACTGAGGCCGGGAGGAGG - Intronic
969554369 4:7896540-7896562 TGAGGACTGAGCCCTGGGTGTGG - Intronic
969554387 4:7896598-7896620 TGAGGACTGAGCCCTGGGTGTGG - Intronic
969554405 4:7896656-7896678 TGAGGACTGAGCCCTGGGTGTGG - Intronic
969554423 4:7896714-7896736 TGAGGACTGAGCCCTGGGTGTGG - Intronic
969554440 4:7896772-7896794 TGAGGACTGAGCCCTGGGTGTGG - Intronic
969554450 4:7896801-7896823 TGAGGACTGAGCCCTGGGTGTGG - Intronic
969673504 4:8602394-8602416 TTGCCACTGAGGCCTGGATGTGG + Intronic
970191372 4:13522597-13522619 GGAGCACAGTAGCCTGGCTGCGG - Intergenic
970665643 4:18333470-18333492 TCAGGGCTGTGCCCTGGATGTGG - Intergenic
971134415 4:23852479-23852501 TGAGTGATGTGGCCTTGATGGGG - Intronic
971420996 4:26474132-26474154 TAAGCACAGGGGCCTGGGTGCGG + Intergenic
972725708 4:41745491-41745513 TGAGCAGCGCGGCCTGGACGCGG - Exonic
973614308 4:52663551-52663573 GTACCAGTGTGGCCTGGATGTGG + Intergenic
975434352 4:74334288-74334310 TGGGCACTGGTGTCTGGATGAGG + Intergenic
975724409 4:77278095-77278117 TTAGCAATGTGACCTGGAAGAGG - Intronic
975940321 4:79636416-79636438 TCAGTAATGTGGCCTGGAGGTGG + Intergenic
976255957 4:83101034-83101056 AGAGCACTGGGGCCTTGCTGTGG - Intronic
981335426 4:143563418-143563440 GTACCAGTGTGGCCTGGATGTGG + Intergenic
983265195 4:165500927-165500949 TGAGCACTGTTGGCCGGGTGCGG + Intergenic
983705151 4:170648472-170648494 TGTGCACAATGACCTGGATGGGG + Intergenic
984694330 4:182764489-182764511 TGAGAACTGGGGACAGGATGAGG + Intronic
984713417 4:182904494-182904516 TGAGCACTGGGCACTGGAAGAGG + Intronic
985572060 5:652185-652207 TGAGCACTGTGGCCTGGATGTGG + Intronic
985576927 5:677901-677923 TGAGCTCAGTGCCCTGGAGGAGG - Exonic
985784178 5:1885605-1885627 TGAGTAGTGGGGCCTGGGTGAGG - Intronic
997868663 5:137487728-137487750 TGAGCACAGTGGAATTGATGTGG - Intronic
999701285 5:154230819-154230841 TAAGAACTGTGACCTGGATTAGG - Intronic
1002132754 5:177091589-177091611 AGAGCCCTGTGGGCAGGATGAGG + Intronic
1002440011 5:179259348-179259370 AGTGCACTGTGGGCTGTATGAGG + Intronic
1003265309 6:4560637-4560659 TGAGCACTGGGCTCTGGGTGGGG - Intergenic
1006116699 6:31779531-31779553 GGAGCACTGTGGGGTGGAGGAGG + Exonic
1006366584 6:33619770-33619792 TTGGCACAGTGGACTGGATGAGG + Intergenic
1007147478 6:39650243-39650265 AGAGCACTCTGGCCTGGATTTGG - Intronic
1007264460 6:40586493-40586515 TGAGCTCTGTGGACTGGGTGGGG - Intronic
1010162056 6:72868173-72868195 CAAGCACTGTGGCTTGGATTAGG + Intronic
1010498555 6:76566722-76566744 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
1010576392 6:77536926-77536948 TGAGTACTGTGGGATGGGTGGGG + Intergenic
1013087246 6:106866983-106867005 TGGGCACTGGTGTCTGGATGAGG - Intergenic
1013542275 6:111122459-111122481 TGTTCACTGTGGGCTGGCTGGGG + Intronic
1017889818 6:158628886-158628908 AGAGCACTGTGGGGTGGCTGAGG + Intronic
1021027556 7:15687273-15687295 TGAGCACCATGGCCTGGAAAAGG + Intergenic
1023807975 7:43888135-43888157 TTAACACTGTGGTCTGGAAGGGG + Intronic
1023942707 7:44780247-44780269 TGATCAGTGTGGGATGGATGAGG - Intergenic
1028479091 7:91284883-91284905 TTAGCACTATGGTTTGGATGTGG - Intergenic
1029194767 7:98797522-98797544 AGAGCCCTGAGGACTGGATGTGG + Intergenic
1033413718 7:141144515-141144537 AGAGCACAGAGGGCTGGATGGGG + Intronic
1033609644 7:142953413-142953435 TGAGGACTGTGGGCAGGAGGAGG - Intronic
1034258308 7:149736655-149736677 TGTGCAGTGTGGCTTGGAAGAGG + Intergenic
1034998746 7:155594788-155594810 TGGGCACTGTGGCCTGACTGTGG - Intergenic
1035748532 8:1978955-1978977 TGTGCACTGTGGGCTGGGGGTGG - Intronic
1036499092 8:9296951-9296973 AGAGAACAGTGGCCTGGCTGGGG - Intergenic
1036642457 8:10592871-10592893 TGAGCCCTGTGCTCTGGGTGGGG + Intergenic
1036706940 8:11053201-11053223 AGATGACTGAGGCCTGGATGAGG - Intronic
1037602454 8:20408893-20408915 TTAGCACTGTGGCCTGCAAATGG - Intergenic
1040987914 8:53316841-53316863 TGAGGACTGTGGGAGGGATGAGG + Intergenic
1041386413 8:57309232-57309254 TGAGCACTGAGGACTGAAAGAGG + Intergenic
1042981653 8:74536266-74536288 TGAGCACTGAGGCCTGTTGGGGG - Intergenic
1045079022 8:98604296-98604318 TTATCAGTGTGCCCTGGATGTGG - Intronic
1047053181 8:121136181-121136203 TGAGTAGTGGGGACTGGATGTGG - Intergenic
1047390296 8:124445156-124445178 TGAAGACTGTGGCCTCCATGCGG + Intergenic
1047957804 8:129988582-129988604 TGACCTCAGTGGACTGGATGTGG - Intronic
1049306974 8:141909179-141909201 TGAGGCCTGTGGCCTGAATTTGG + Intergenic
1049347635 8:142147234-142147256 TGAGCACTGTGCCCTGAAGAAGG + Intergenic
1050057005 9:1666295-1666317 TGATCACTCTGGCCTCCATGTGG - Intergenic
1050697803 9:8298378-8298400 TGAACACTGTGGGCTGGAGGTGG - Intergenic
1051493265 9:17690632-17690654 TGTGCACTGTGGCTTGCATGTGG + Intronic
1052686571 9:31764854-31764876 GCATCAGTGTGGCCTGGATGTGG - Intergenic
1052829560 9:33203676-33203698 TGACCAATATGTCCTGGATGAGG + Intergenic
1053168269 9:35859905-35859927 CGAGCACTGTAACCTGGAGGTGG - Intergenic
1054971978 9:71098685-71098707 TGACCACACTGGCCTGGAAGTGG + Intronic
1058933900 9:109749768-109749790 TGAGCACTGTGAGAAGGATGTGG + Intronic
1060470333 9:123943092-123943114 GGAGCATGGTGGCCTGGCTGGGG + Intergenic
1061920098 9:133778010-133778032 TGAGCACTGGGGCTTGGTAGAGG + Intronic
1062090835 9:134678046-134678068 AGAGCACTGGGGCCATGATGAGG - Intronic
1062239398 9:135527531-135527553 CGAGCACTGAGGCCTGGTTAGGG - Intergenic
1062267418 9:135693662-135693684 GGAGCCGTGGGGCCTGGATGTGG - Exonic
1186487446 X:9944568-9944590 TGAGCAGTGTGGCCGGGGTGGGG + Intronic
1189886137 X:45546485-45546507 GCAGCAGTGTGCCCTGGATGTGG + Intergenic
1190082860 X:47370497-47370519 TGAACATTGTGGCGTGAATGTGG + Intergenic
1190736262 X:53257317-53257339 TTTGCACTGGGGGCTGGATGTGG + Intronic
1191735453 X:64384182-64384204 ACAGCAGTGTGCCCTGGATGTGG - Intronic
1192410748 X:70930537-70930559 TGAGCAGTGTGGGCTTGGTGAGG - Intronic
1195021041 X:100828930-100828952 TGAGTAATGTGGACTGGATTTGG + Intronic
1197326592 X:125102092-125102114 TGAGCATTGTGGGCTGGAGTTGG + Intergenic
1198591741 X:138190691-138190713 TGAGAATGGTGGCCTGGTTGAGG + Intergenic
1199092740 X:143711282-143711304 TGAGGTATGTGGCCTGGAGGTGG + Intergenic
1199241254 X:145550235-145550257 TGAGCTCTGTGCCCTGGCAGAGG + Intergenic
1199384648 X:147209035-147209057 GCAGCAGTGTGCCCTGGATGTGG + Intergenic
1201187854 Y:11421247-11421269 AGAGCACAGTAGGCTGGATGTGG - Intergenic
1201273807 Y:12280806-12280828 AGAGCCCTGTGGCCAAGATGTGG - Intergenic