ID: 985572062

View in Genome Browser
Species Human (GRCh38)
Location 5:652195-652217
Sequence GGCCTGGATGTGGACAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985572052_985572062 30 Left 985572052 5:652142-652164 CCTGTCTGTGGCAGGTCAAGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 985572062 5:652195-652217 GGCCTGGATGTGGACAAGGCAGG 0: 1
1: 0
2: 3
3: 26
4: 285
985572059_985572062 -10 Left 985572059 5:652182-652204 CCTTGAGCACTGTGGCCTGGATG 0: 1
1: 1
2: 1
3: 33
4: 314
Right 985572062 5:652195-652217 GGCCTGGATGTGGACAAGGCAGG 0: 1
1: 0
2: 3
3: 26
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985572062 Original CRISPR GGCCTGGATGTGGACAAGGC AGG Intronic
900383452 1:2397466-2397488 GGCCTGGACGTGCCCAGGGCAGG - Intronic
900399330 1:2466593-2466615 GCCCCGGATGTGGGCAGGGCAGG - Intronic
900653267 1:3741815-3741837 AGCCAGGATGAGGACATGGCTGG + Intergenic
901636732 1:10674037-10674059 GGACTGAATGGCGACAAGGCAGG + Intronic
901737874 1:11323804-11323826 GGCCTGGAGATGGCCCAGGCTGG - Intergenic
902295220 1:15462671-15462693 GGCCTGGCTTTGGATAATGCTGG - Intronic
902719404 1:18294128-18294150 TGCCAGGATGTGGAAGAGGCAGG - Intronic
903135372 1:21306026-21306048 TGGCTGGATGTGGAGAAGGATGG - Intronic
903453734 1:23472539-23472561 AGCCTGATTTTGGACAAGGCAGG - Intronic
904809271 1:33152860-33152882 GCCCAGGATGGGGAGAAGGCAGG + Intronic
905068389 1:35204168-35204190 GGTCTGGATATGGACTATGCAGG - Intergenic
905265397 1:36750851-36750873 GGCCTGCATGTTGACTGGGCTGG + Intergenic
905665426 1:39760656-39760678 GGCCTGGAGATGGCCAGGGCAGG - Intronic
906704761 1:47886897-47886919 GGTGTGGAGGTGGAGAAGGCTGG - Intronic
907314705 1:53560896-53560918 TGCCTGGCTGTGGGCAGGGCGGG - Intronic
908248020 1:62243201-62243223 GGCCAGGCTGAGGACCAGGCAGG - Intronic
909869572 1:80722697-80722719 GGCCTGGAGGCTGACAAGCCAGG + Intergenic
911042165 1:93599599-93599621 GGGCTGGATGGGGCCAGGGCTGG + Intronic
912206607 1:107515991-107516013 GGCCTGCATGAGGAGAAGGTGGG - Intergenic
912948658 1:114105514-114105536 GGCCTGGCTGGGGCCAGGGCGGG + Intronic
915627198 1:157122182-157122204 GGCCTGGCTTTGTACCAGGCTGG + Exonic
918174168 1:182029064-182029086 GGCATTGATGTGGACTAGGATGG - Intergenic
920030847 1:203036576-203036598 GGCCTGGATGTGGATGAGCTTGG + Intronic
920692518 1:208157970-208157992 GGCCTGGCTGGGGACAAGGATGG - Intronic
921301013 1:213751546-213751568 TGCCCTGATGTGGACAGGGCTGG + Intergenic
923158546 1:231298790-231298812 GGCCGGGAGGTTAACAAGGCAGG - Intergenic
1063932544 10:11043660-11043682 GGCCTGGATGTGGAGAATGTGGG - Intronic
1066010907 10:31192581-31192603 GGCTAGGCTGTGGACGAGGCTGG + Intergenic
1066373412 10:34836558-34836580 GGAATAAATGTGGACAAGGCAGG - Intergenic
1067175014 10:43939502-43939524 GGCCTGGATGGGGGCTGGGCTGG + Intergenic
1067520055 10:46993211-46993233 GGCCTGGAAATGGACCTGGCAGG - Intronic
1067833116 10:49621619-49621641 GCCCTGGGTCTGGACAGGGCAGG - Intronic
1069834729 10:71301325-71301347 GGCCTGGCTGTGGGCAAAGGAGG + Exonic
1070657176 10:78279591-78279613 GGCTGGGCTGTGGAGAAGGCTGG - Intergenic
1071894575 10:90051588-90051610 TGCCTGGATGTGGAGAAGAGAGG + Intergenic
1074078882 10:110152200-110152222 GGCCCAGATGGGGACATGGCAGG - Intergenic
1074221388 10:111441599-111441621 GGCATGGATGTGTACAGGGTGGG + Intergenic
1075271897 10:121059609-121059631 GGACTGGGTGTGGTCTAGGCAGG - Intergenic
1075347548 10:121695144-121695166 AGCCTGGATGTGAAACAGGCAGG - Intergenic
1075488566 10:122847370-122847392 GGGCTGGCTGTGGATGAGGCAGG + Intronic
1075874207 10:125793127-125793149 GCCATGGGTGTGGACAATGCAGG + Intronic
1076215179 10:128687407-128687429 GGCCTGCCTGTGGACAAGCTTGG + Intergenic
1076623653 10:131808750-131808772 CGCCGGGATGTGGAGGAGGCAGG - Intergenic
1076882018 10:133244266-133244288 GGCCTGGAAGCCGACAAGTCTGG - Intergenic
1076991554 11:278688-278710 GGGAAGGATGTGGACAAGGGTGG - Intronic
1077392846 11:2308029-2308051 GGCATGGACCTGGACAGGGCCGG - Intronic
1077618511 11:3697214-3697236 GGTCTGTATGTTGACCAGGCTGG - Intronic
1077970758 11:7187619-7187641 GGCCTGTCAGTGGCCAAGGCTGG - Intergenic
1078060091 11:8037717-8037739 GGCCTGGTAGTAGATAAGGCTGG + Intronic
1079156133 11:17949602-17949624 TGTCTGGATGTGGCCAAAGCAGG + Intronic
1079244816 11:18744232-18744254 GCCCTGCCTGTGGACAGGGCCGG - Intronic
1080201372 11:29674919-29674941 GGCTTGCATTTGGAAAAGGCTGG + Intergenic
1082804660 11:57440082-57440104 GGCCAGGAAGTGGCCAAGGCAGG + Intergenic
1083633590 11:64108479-64108501 GGCCAGGAGGTAGACAGGGCAGG - Intronic
1083815548 11:65130587-65130609 GGGCTGGATGTGGAAGATGCTGG - Intronic
1084308219 11:68300294-68300316 GGCCTGGAGGAGGACAAGGGAGG + Intergenic
1084429297 11:69102350-69102372 CTCCTGGAAGTGGACAGGGCAGG + Intergenic
1084568923 11:69948149-69948171 GGCCTGGATATGGCCATCGCTGG - Intergenic
1084736455 11:71108600-71108622 GGCAGTGACGTGGACAAGGCTGG - Intronic
1087377872 11:97367358-97367380 GGGCTGAATGTGGAGAAAGCTGG + Intergenic
1088378310 11:109166136-109166158 GGCCTGGATAAGGAGGAGGCTGG - Intergenic
1089626213 11:119752590-119752612 AGACTGGATGTGGATAAGGCTGG - Intergenic
1090415718 11:126538950-126538972 GGCCAGGATGAAGACAAGGTGGG + Intronic
1090641019 11:128728789-128728811 GGACTTGATGTAGCCAAGGCAGG - Intronic
1091447548 12:552688-552710 TGCCTGGATATGGAAAAGGCAGG - Intronic
1093299334 12:17434976-17434998 GGCCAGGATGTGGAGAAAACAGG - Intergenic
1096282574 12:50268987-50269009 GGCTTAGATGTGGAATAGGCTGG - Intronic
1096793496 12:54059903-54059925 GGCCTGGATGTGGGCTCTGCTGG - Intergenic
1096857052 12:54491001-54491023 GGCCTTGATGTTGCCGAGGCTGG + Intergenic
1096966695 12:55633537-55633559 GGCCTGGATGAGGACAGGGAGGG + Intergenic
1097509354 12:60517674-60517696 TGTCTGGATGTGGGAAAGGCGGG - Intergenic
1098109578 12:67107964-67107986 GGCTGAGATGTGGACTAGGCAGG - Intergenic
1099959661 12:89384527-89384549 GGCCTGGAGGTGAAACAGGCAGG + Intergenic
1100183327 12:92108835-92108857 GGCCTGGTAGTGGAGAAGGGAGG - Intronic
1101948265 12:109154625-109154647 GGCCTGGGTGGGGCCTAGGCGGG + Intronic
1102820585 12:115906018-115906040 GTCCGGGATGTGGGCAAGGGAGG - Intergenic
1104810370 12:131616897-131616919 GGCTGGGAGGTGGACAGGGCGGG - Intergenic
1108344041 13:49526850-49526872 GGCCTGTGTGTGGCCCAGGCAGG + Intronic
1111911351 13:94315872-94315894 GGCCTGCATGTGGCCCAGGATGG + Intronic
1112305191 13:98267328-98267350 TGGCTGGATGTGGAAAGGGCCGG + Intronic
1112441234 13:99426415-99426437 GGGCTGGGTGTGGAGAGGGCAGG - Intergenic
1113372254 13:109734229-109734251 GGCCTGGATGTTGGCAATGGTGG - Intergenic
1113893226 13:113747598-113747620 GGCATGGATGAGGAGAAGGCTGG + Intergenic
1119525720 14:75320821-75320843 GGCCTTGATCTGCACAGGGCAGG + Intergenic
1121260841 14:92565037-92565059 GTCCTGGAGGTGGACAAAGGTGG + Intronic
1122883387 14:104699990-104700012 GGCTTGGTCGTGGACCAGGCTGG + Intronic
1123921946 15:25076423-25076445 GGCCTGGATGTGAAGCATGCAGG - Intergenic
1126135853 15:45390255-45390277 GGTCTGGCTGTTGACAGGGCTGG + Intronic
1126567409 15:50114506-50114528 GGACAGGATGAGGACAAGGAGGG - Intronic
1128559042 15:68652451-68652473 GGCCTGGATCTGGAGGTGGCAGG - Intronic
1129248897 15:74297338-74297360 GGCCAGGATGTGGAGAGGGCAGG - Intronic
1130534448 15:84773561-84773583 CCCCTGGATGGGGACAAGACAGG - Intronic
1132785596 16:1655611-1655633 GCCATGGATGTGAAGAAGGCTGG - Intronic
1132881275 16:2162737-2162759 GGCCTCGAGGTGGACAGTGCAGG + Intronic
1133141009 16:3744175-3744197 GGCCTGCATGTGGACTTGGCTGG - Intronic
1133323624 16:4930344-4930366 TGACTGGATGGGGACAGGGCAGG + Intronic
1133955719 16:10442183-10442205 TGCCTGGGTGTGTAAAAGGCAGG + Intronic
1134096292 16:11421036-11421058 GGCCTGGGTGTGGCCCAGGGTGG - Intronic
1136654772 16:31703256-31703278 GGGCTGGATGAGGCCAAGCCAGG + Intergenic
1137494646 16:48960514-48960536 AGCCTGGAGATGGACCAGGCCGG + Intergenic
1137514091 16:49127545-49127567 GGCCAGGATGTGCACATGACTGG - Intergenic
1137582387 16:49641229-49641251 GGCCTGAATGTGGACAGTCCTGG - Intronic
1138348940 16:56336208-56336230 GGTCTGGCTGTGGACAAAGCTGG - Intronic
1138591478 16:58001540-58001562 GGACGGGATGCGGACCAGGCCGG + Exonic
1139373095 16:66480472-66480494 GTCCTGGCTGTGGACCAGGGTGG - Intronic
1140663211 16:77207572-77207594 TGCCTGGATTTTGACAGGGCGGG + Intronic
1141082102 16:81061609-81061631 GTGCTGGATGTGGAAAAGGATGG - Exonic
1142285831 16:89171232-89171254 GGCCAGGCTGTGGGGAAGGCAGG - Intergenic
1142869262 17:2809677-2809699 GAGCTGGATTTGGCCAAGGCCGG + Intronic
1142891586 17:2947449-2947471 GGCCTGGGAGTGGCCAGGGCGGG - Intronic
1143711192 17:8736391-8736413 GGCATGGTTCTGGACCAGGCTGG - Intronic
1143711514 17:8739198-8739220 GGCCTGGATGAGGAAGGGGCAGG + Intronic
1144188607 17:12822074-12822096 AGCCTGGATTTGGTCAAGGAGGG + Intronic
1144756974 17:17685794-17685816 GGACTGAATGAGGACAGGGCAGG - Intronic
1144852613 17:18251649-18251671 GGCCAGGGTTGGGACAAGGCAGG - Intronic
1146380318 17:32322957-32322979 GGCCAGGATGGGCACCAGGCTGG - Exonic
1147767139 17:42844758-42844780 GGCCAGGGTGTGGCCAGGGCTGG - Exonic
1147768334 17:42851487-42851509 GGCCAGGGTGTGTCCAAGGCTGG - Exonic
1147770926 17:42867419-42867441 GGCCAGGGTGTGTCCAAGGCTGG - Intergenic
1148818299 17:50346249-50346271 GGCCTGGAGGAGGACGAGGCGGG + Exonic
1149936284 17:60810349-60810371 GGCCTGGTTGTGGGGATGGCGGG + Intronic
1150125583 17:62632552-62632574 AGCCTGGAGGTGGAGAAAGCTGG - Intronic
1150209815 17:63435821-63435843 GGGTTGGATGTGGAAAAGGAAGG + Intronic
1150654998 17:67033556-67033578 GGCCAGGCTCTGGCCAAGGCCGG + Intergenic
1151285463 17:73107818-73107840 GCTCTGGATGGGAACAAGGCCGG + Intergenic
1151585083 17:75003895-75003917 GGCCAGGGTGAGGTCAAGGCAGG + Exonic
1151875745 17:76867471-76867493 GGCCGGGAGGTGGGCAGGGCAGG + Intergenic
1152085385 17:78214592-78214614 GGCCTCGATGGGGACAAAGCAGG - Intronic
1152614376 17:81331089-81331111 AGCCTGGATCTGGCCAGGGCTGG + Intergenic
1152705768 17:81842887-81842909 ACCCTGGATGTGGACACGGGTGG - Intergenic
1153907920 18:9679329-9679351 GGCCTGGCTGTGGGAATGGCCGG - Intergenic
1154056635 18:11019021-11019043 GGCTTGGATGTGGACTATGAAGG - Intronic
1155154550 18:23147796-23147818 GGCCTGGGTGTGGGCAAAACCGG - Intronic
1155246926 18:23919676-23919698 GGCCTGGAGGTGGGAAGGGCAGG + Intronic
1156282717 18:35656782-35656804 GGACTGGAAGAGGACGAGGCAGG + Intronic
1157562284 18:48656814-48656836 GGCCTGGATGCTGTCAGGGCTGG + Intronic
1160412453 18:78684172-78684194 AGCTTGGATGTGGCCATGGCCGG - Intergenic
1160981526 19:1818648-1818670 GTGCGGGATGTGGGCAAGGCCGG - Intronic
1161055672 19:2189648-2189670 GGACAGCATGTGGATAAGGCAGG - Intronic
1161252174 19:3286070-3286092 AGCCTGCAGGTGGACAGGGCGGG - Intronic
1161638460 19:5404317-5404339 GCCCTGCATGTGGACAGTGCAGG - Intergenic
1161652894 19:5496231-5496253 GGCCTGGAGGTAGAGCAGGCAGG + Intergenic
1163790820 19:19305264-19305286 GTCCTGAATGTGGACAGGGCTGG + Intronic
1165902691 19:39176153-39176175 GGCCTGGTTGTCGCAAAGGCAGG + Intronic
1166517162 19:43455880-43455902 GGGCTTGCTGGGGACAAGGCAGG - Intergenic
926679382 2:15652369-15652391 GGCAGGAAGGTGGACAAGGCAGG - Intergenic
926855471 2:17251607-17251629 TGCCTGCCTGTGGATAAGGCAGG - Intergenic
927853491 2:26514090-26514112 GGCCTGGTTGTGGAAAAGAGGGG - Intronic
929030585 2:37646796-37646818 GTCCTGGTTGTGGTCAAGACTGG - Exonic
929596276 2:43178384-43178406 GGCCCGGAGGTGGAGGAGGCAGG + Intergenic
929602471 2:43212993-43213015 GGCCTGGAAGAGGACCAGCCAGG + Intergenic
929788457 2:45008052-45008074 GACCTGGATGGGGAAAAGCCAGG - Intronic
932337444 2:70939078-70939100 GGCCGGGATGGGGGCAAGCCCGG - Intronic
932435642 2:71701234-71701256 GGCCTGGAGGTGAGCAGGGCAGG - Intergenic
932628759 2:73320503-73320525 GGCCTGGATATATAGAAGGCCGG + Intergenic
933124667 2:78589686-78589708 AGTCTGGATATGGACAAGACGGG - Intergenic
933398787 2:81765387-81765409 GCCCAGGATGAGGACATGGCAGG - Intergenic
935429299 2:102957499-102957521 GGCCTTGAGGAGGACAAGGGAGG + Intergenic
935607837 2:104988397-104988419 GGCCTCCCTGTGGACAAGGATGG + Intergenic
936016295 2:108961463-108961485 GGCCTGGCTGTGAGCAGGGCAGG - Intronic
936521069 2:113212505-113212527 GCCTTGGCTGTGGAGAAGGCAGG + Intergenic
937135657 2:119549917-119549939 GACCTGGATGTTGACTAGGGTGG + Intronic
938293428 2:130162303-130162325 GGGCAGGATGTGCACCAGGCCGG - Intronic
938463126 2:131510658-131510680 GGGCAGGATGTGCACCAGGCCGG + Intergenic
941584261 2:167337049-167337071 GGTCAGGGTGTGGACAAGCCAGG + Intergenic
941749707 2:169121284-169121306 GGCCTGCATGTGGACTTTGCTGG - Intergenic
943015209 2:182502044-182502066 GGACAGGAGGTGGACAGGGCAGG - Intronic
944039851 2:195340662-195340684 GCCCTGCATGTGTACAAGACAGG + Intergenic
944605344 2:201347235-201347257 GGCCTGGACCAGGGCAAGGCTGG + Intronic
944728403 2:202495538-202495560 GCCCAGGATGGGGACATGGCGGG + Intronic
945305455 2:208255106-208255128 GGCCTGGGAGGGGACAAAGCCGG - Intronic
946306724 2:218860454-218860476 GGGCTGGATTTGGAGAAGACAGG + Intronic
946312424 2:218890193-218890215 GGGCTGGCTGTGGGCAGGGCTGG - Exonic
948320459 2:237064633-237064655 TGCCTGGAGGGGGACAAGGGTGG - Intergenic
948997143 2:241587315-241587337 GGCCTGGAGGTGTCCAAGGACGG - Intronic
1169091584 20:2864281-2864303 GACCTGGGTGAGGGCAAGGCTGG + Exonic
1169194459 20:3675693-3675715 GGAGTGGGTGTGGAGAAGGCAGG - Intronic
1170582543 20:17710176-17710198 GCCCTGCAAGTGGACAGGGCTGG - Intronic
1172603540 20:36199780-36199802 GGCCTGGCTGTGGGCGAGGTGGG + Intronic
1172698461 20:36838013-36838035 GGCCTAGAGTTGGTCAAGGCTGG - Intronic
1172834357 20:37863551-37863573 GGCCTGGAGGAGGACAGGGCAGG + Intronic
1173226706 20:41166405-41166427 GGCCTGGGGGCGGACAAGGCAGG + Intronic
1173662378 20:44743711-44743733 GGCATGGTTGTGGACACAGCTGG - Intergenic
1175104243 20:56603175-56603197 TGCCTGGAAGTGGGGAAGGCAGG - Intergenic
1175917631 20:62434268-62434290 GTCCTGGATGGGGACATGGCGGG + Intergenic
1177902602 21:26934888-26934910 GGACTCCATGGGGACAAGGCTGG + Intronic
1180198003 21:46208856-46208878 GGCCTCTGTGTGGCCAAGGCTGG - Intronic
1180635544 22:17260308-17260330 TTCCTGCTTGTGGACAAGGCAGG + Intergenic
1181050146 22:20234511-20234533 GGGATGGATATGGACAGGGCGGG + Intergenic
1181843923 22:25690679-25690701 TGCGTGGATGTGGTCAAGGGAGG + Intronic
1182620980 22:31618375-31618397 GGCCTGGATGCGGGCAACGCAGG - Exonic
1183659826 22:39212767-39212789 GGCCTGGATATGGAGGAGGAGGG + Intergenic
1184694325 22:46131264-46131286 TGCCTGGATGTGGGCTAGGAGGG - Intergenic
1184747045 22:46462117-46462139 GGCTCGGCTGTGGGCAAGGCAGG - Intronic
1184769400 22:46588805-46588827 AGCCTGGATGTGGCCCAGGCTGG + Intronic
1185331217 22:50252826-50252848 GGCCTGCATGTAGAGGAGGCTGG - Intronic
1185398708 22:50605163-50605185 GGTCTGGCTGTGGTCAGGGCTGG + Intronic
950138837 3:10601443-10601465 GGCCTGGCTGTGCCCCAGGCTGG + Intronic
950155647 3:10719702-10719724 TGCCTGGAAGTGGGCACGGCAGG + Intergenic
951113912 3:18837494-18837516 GGCATAGCTGTGGACCAGGCTGG - Intergenic
952418236 3:33108679-33108701 GGCATGGATGTGGAGAAGGCAGG + Intergenic
954364016 3:50136878-50136900 AGCCGGGATGTGGCAAAGGCAGG + Intergenic
960302974 3:116026752-116026774 GGCATGGATGTGGCAAAGGATGG - Intronic
961658122 3:128454320-128454342 TGCCTGCATGTGGCCAAGGCTGG - Intergenic
963004673 3:140715340-140715362 GGTCTCCATGTGGAAAAGGCTGG - Intergenic
963778026 3:149459635-149459657 GGCGTGGATGTGGGAAGGGCTGG + Intergenic
963901062 3:150733932-150733954 GGATGGGAGGTGGACAAGGCTGG + Intergenic
963920220 3:150898074-150898096 AGCCAGGATGTGGACCAAGCAGG - Intronic
966133743 3:176674563-176674585 GGCCAGGGGCTGGACAAGGCTGG - Intergenic
966928296 3:184659719-184659741 GGCCTGGCTGGGGGAAAGGCAGG + Intronic
967221794 3:187253518-187253540 GCTCTTGACGTGGACAAGGCAGG + Intronic
970347109 4:15163114-15163136 GGTCTGGCTGTGGACAGGTCAGG + Intergenic
972255007 4:37344467-37344489 GGCCTGGATGAGGGCAATACTGG + Intronic
975394014 4:73853860-73853882 AGCCTGGAGGTGATCAAGGCCGG + Exonic
975405215 4:73981444-73981466 AGCCTGGAGGTGATCAAGGCCGG - Exonic
976827703 4:89279021-89279043 GGCCTTGACGAGGAGAAGGCAGG + Intronic
979295778 4:119031143-119031165 GGGTTGGATGTGGGGAAGGCAGG - Exonic
980719931 4:136682463-136682485 TGCCTGGTTGTGGACTTGGCAGG + Intergenic
980997086 4:139789570-139789592 GGCCTGGGTGGGGACACTGCAGG + Intronic
983645778 4:169990108-169990130 TGCCTGGCTTTGGACAAGTCTGG - Exonic
985334891 4:188881704-188881726 TGCCAGGATGTGGAAAAGGCTGG + Intergenic
985572062 5:652195-652217 GGCCTGGATGTGGACAAGGCAGG + Intronic
985660531 5:1154977-1154999 GGCCTCTGTGTGGCCAAGGCTGG + Intergenic
986215563 5:5716018-5716040 GACCTGGTTCTGGACATGGCAGG + Intergenic
986321681 5:6636905-6636927 TGCCTGGAAGGGGACAGGGCTGG + Intronic
986514271 5:8544107-8544129 GGCCTGGGTGGGGACAAGGCTGG + Intergenic
988527347 5:31998807-31998829 GGCCTGCATGTGGCCCAGGATGG - Intronic
995301244 5:110585818-110585840 GGCCTGGAACTGGACATGTCAGG - Intronic
995531400 5:113095208-113095230 GGCTAGGATGAGGACAAGGGTGG + Intronic
996191881 5:120554572-120554594 TGCCTGAATGGGGACAAGGCTGG + Intronic
996405294 5:123098174-123098196 GGCCTGGCTGCGGCCAAGGCTGG + Intronic
996887462 5:128374642-128374664 GGCCTGGCTGTGGGCATGGATGG - Exonic
997237242 5:132279929-132279951 GATCTGAGTGTGGACAAGGCTGG + Intronic
997260111 5:132459368-132459390 GACCTGGGTGTGGCCAAGGGAGG + Intronic
998448565 5:142217115-142217137 GGCCTGGAGGTGGAAAGGGTGGG + Intergenic
999282118 5:150372720-150372742 GGCCTGGGGCAGGACAAGGCGGG + Intronic
999308287 5:150534957-150534979 GGACTGGTTGTGGAAAAGGTGGG - Exonic
999316043 5:150584812-150584834 TGCCTGAATCTGGACAAGCCAGG - Intergenic
999370038 5:151049268-151049290 GACCTGGATGTGGCCAGTGCTGG + Intronic
999930731 5:156430986-156431008 GGACTGGTTGTAGATAAGGCAGG + Intronic
1000043552 5:157502978-157503000 TGCCTGGCAGAGGACAAGGCTGG + Exonic
1001124334 5:169006032-169006054 GTCCTTGTGGTGGACAAGGCAGG + Intronic
1001213862 5:169837053-169837075 GGAGTGGATGGGGACTAGGCAGG - Intronic
1002197229 5:177508170-177508192 AGCGTGGAGGTGGACAAGTCGGG + Intronic
1002402069 5:178996414-178996436 TGCGGGGATTTGGACAAGGCTGG + Intergenic
1002527343 5:179821853-179821875 GGGCGGGAGGTGGCCAAGGCCGG + Intronic
1002844481 6:934882-934904 GGACCGCATGAGGACAAGGCTGG - Intergenic
1003029920 6:2592991-2593013 GGACTGGATGCTGAGAAGGCTGG + Intergenic
1003173882 6:3740719-3740741 AGCCTGGAGGTGGAGGAGGCTGG - Intronic
1003268528 6:4587700-4587722 GGCTTGGCTGTGGAAAGGGCTGG - Intergenic
1003315915 6:5011610-5011632 GGCATGGATGTGCACACGGAAGG + Intergenic
1003527269 6:6908849-6908871 GGTCTGGCTGTGGCCCAGGCTGG - Intergenic
1004736446 6:18410773-18410795 GGACTGAAAGTGGGCAAGGCTGG + Intronic
1005084652 6:21992694-21992716 GTCCTGGTAATGGACAAGGCAGG - Intergenic
1005850169 6:29814937-29814959 GACCGGGATGGGGACAAAGCAGG + Intergenic
1007000059 6:38302778-38302800 GGCATGGATGTGGAGAAAGGGGG - Intronic
1007785938 6:44279315-44279337 GGCCTGGCTGGGGAGAAGACAGG + Exonic
1009526388 6:64751505-64751527 TGCCTGGAGCTGGACCAGGCAGG - Intronic
1009658018 6:66570490-66570512 GGCCTCGAGTTGGACAAGCCTGG + Intergenic
1010174637 6:73013677-73013699 GGCCTGGCTGAGGAAAAGACTGG + Intronic
1013916322 6:115341822-115341844 GGCCTGCATGTGGCCCAGGATGG + Intergenic
1016986020 6:149896520-149896542 GGCCTGGATGTGTACAGAACAGG - Intronic
1018471338 6:164101109-164101131 GGCCTGCAGGTGGAGAAGGGGGG - Intergenic
1019276937 7:180573-180595 GGCCAGGCGATGGACAAGGCCGG - Intergenic
1019512915 7:1426946-1426968 GGACAGGATGTGGACGAGGGAGG + Intergenic
1021574388 7:22094131-22094153 TGCCTGGACCTGGACAAGGCAGG - Intergenic
1022495901 7:30853043-30853065 GGCAGGGAGGTGGATAAGGCAGG - Intronic
1024579099 7:50787618-50787640 GGCCTAGGTGGGGAGAAGGCCGG + Intronic
1024856081 7:53780803-53780825 GGCATGGGTGTGGACAGAGCTGG + Intergenic
1025262777 7:57430853-57430875 TGCCTGCATGTGGACACGGAAGG - Intergenic
1026991092 7:74586265-74586287 TGCATGGATTTGGACAAGGGTGG + Intronic
1027439043 7:78198194-78198216 GGCCTGGGTGTGGACACCACTGG - Intronic
1027460958 7:78453131-78453153 GGTCTGGATGTGGCAAAGTCAGG - Intronic
1032441601 7:131946422-131946444 GGCCAGGTTGTGGGAAAGGCTGG + Intergenic
1032480012 7:132238849-132238871 GGCAGGAATGTTGACAAGGCTGG - Intronic
1034355414 7:150447267-150447289 TGCCTGGATGTGGAGCAGCCTGG - Intergenic
1034872518 7:154696603-154696625 GGCCTGGATGGGGACCAGGCTGG - Intronic
1035052062 7:156004734-156004756 GGCCTGCTTGGGGACAAGCCCGG + Intergenic
1035687631 8:1537337-1537359 GGGGTGGAGGTGAACAAGGCAGG + Intronic
1037838150 8:22226783-22226805 GGCTTTGCTGTGGTCAAGGCGGG - Intronic
1040569310 8:48593642-48593664 GGGCTGGGTGTGGAGAAGGTGGG + Intergenic
1043015858 8:74940142-74940164 TGCCTGGATCTGGACATGGGGGG + Intergenic
1044834911 8:96286489-96286511 GGACTGGAGGAGGGCAAGGCTGG - Intronic
1046229560 8:111335373-111335395 GGCCAGGATGGGGGCATGGCGGG + Intergenic
1046354997 8:113070953-113070975 GGCCAGGATGTGGACAAAAGGGG - Intronic
1047702437 8:127462633-127462655 GGCCTTGAGGAGGAGAAGGCTGG - Intergenic
1048893061 8:138964996-138965018 TGCCTGCATGTAGACGAGGCAGG + Intergenic
1049022714 8:139968740-139968762 GGCCGGGATGAGGACAAGTTGGG - Intronic
1049154214 8:141057028-141057050 TGTCTGGTTGGGGACAAGGCAGG - Intergenic
1052661211 9:31434620-31434642 GTCCTGAATGTGGGGAAGGCAGG - Intergenic
1053169501 9:35868724-35868746 GGCCTAGAGTTGGGCAAGGCTGG + Intergenic
1056018241 9:82415003-82415025 GGCATGGATGTGGGGAATGCTGG + Intergenic
1056106117 9:83348451-83348473 GGCTTGGATGGGGACTAGGGTGG + Intronic
1056922979 9:90808549-90808571 GACCTGGATGTGCACAGGGCAGG + Intronic
1059061854 9:111041409-111041431 GGCCTGGCTGTTGCCCAGGCTGG - Intergenic
1059318067 9:113444044-113444066 GGTAGGGATGAGGACAAGGCAGG + Intergenic
1059804531 9:117784316-117784338 CTCCTGGAGGTGGACAAAGCAGG - Intergenic
1060159186 9:121344511-121344533 GGCCTGTATTTAGACAAAGCCGG - Intronic
1060223305 9:121775582-121775604 AGCAGGGATGTGGACGAGGCTGG - Intronic
1060407681 9:123381027-123381049 GGCCTGGCTGTGGAGGAGACAGG + Exonic
1060733028 9:126049935-126049957 GGCCTGGATCTGGACCATGGTGG - Intergenic
1061845181 9:133383979-133384001 TGCCTGGATGAAGAGAAGGCTGG + Intronic
1062267416 9:135693652-135693674 GGCCTGGATGTGGACTGTGCAGG - Exonic
1062281585 9:135754279-135754301 GCCCTGGCTGTGGTCAATGCTGG + Intronic
1062567599 9:137170216-137170238 CGCCCGGTGGTGGACAAGGCGGG - Intronic
1186904272 X:14094811-14094833 GGTCCGGATGTGGAGAAAGCTGG - Intergenic
1189240634 X:39521922-39521944 GGGCAGGATGAGGACAACGCAGG + Intergenic
1189308285 X:40003582-40003604 GGCCTGGATGTTGGCCAGGAAGG - Intergenic
1190065187 X:47235611-47235633 GGCCTGGATGGAGACAGGGAGGG - Intronic
1192211417 X:69130250-69130272 GCTCTGGATGGGGACAAGGAAGG + Intergenic
1192341729 X:70268638-70268660 GACCTGGATGGGGATAAGGATGG + Intronic
1199708309 X:150450211-150450233 GGCTTGGCAGTGGACAACGCTGG - Intronic
1199783489 X:151083664-151083686 GTCCTGGGTGTGGACAAGCTTGG - Intergenic
1200120919 X:153790154-153790176 CCCCTGGCTGAGGACAAGGCGGG + Intronic
1201361551 Y:13156464-13156486 GGCCTGGAAGTGGAAAAACCTGG + Intergenic