ID: 985574835

View in Genome Browser
Species Human (GRCh38)
Location 5:669259-669281
Sequence GGCTCACCAGCGCCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 6, 3: 39, 4: 336}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985574835_985574854 26 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574854 5:669308-669330 CTCTGTGGCGTGGGGGTCCGCGG 0: 1
1: 0
2: 0
3: 14
4: 182
985574835_985574852 18 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574852 5:669300-669322 CTGGGCAGCTCTGTGGCGTGGGG 0: 1
1: 0
2: 1
3: 38
4: 363
985574835_985574847 11 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574847 5:669293-669315 AGGTGCCCTGGGCAGCTCTGTGG 0: 1
1: 1
2: 3
3: 42
4: 450
985574835_985574845 0 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574845 5:669282-669304 CGGTGAGCCGGAGGTGCCCTGGG No data
985574835_985574841 -9 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574841 5:669273-669295 TGGTGAGCCCGGTGAGCCGGAGG No data
985574835_985574853 19 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574853 5:669301-669323 TGGGCAGCTCTGTGGCGTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 293
985574835_985574844 -1 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574844 5:669281-669303 CCGGTGAGCCGGAGGTGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 163
985574835_985574851 17 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574851 5:669299-669321 CCTGGGCAGCTCTGTGGCGTGGG 0: 1
1: 0
2: 2
3: 47
4: 331
985574835_985574849 16 Left 985574835 5:669259-669281 CCCCCAGGGGGCGCTGGTGAGCC 0: 1
1: 1
2: 6
3: 39
4: 336
Right 985574849 5:669298-669320 CCCTGGGCAGCTCTGTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985574835 Original CRISPR GGCTCACCAGCGCCCCCTGG GGG (reversed) Intronic
900176008 1:1291671-1291693 GGCTCCCCAGCGGCCCAGGGTGG + Exonic
900250414 1:1665859-1665881 GGCTCTGCAGCGCCTCCTGCTGG + Exonic
900296676 1:1955381-1955403 GGCTCTGCGGTGCCCCCTGGAGG - Intronic
900589873 1:3454796-3454818 GGCTCACCTGCGCCGCGGGGCGG - Exonic
900939190 1:5786918-5786940 TGCACACCAGCAGCCCCTGGAGG + Intergenic
901232171 1:7647399-7647421 GGTCGACCAGCGCCACCTGGTGG + Intronic
901468884 1:9441740-9441762 TGCTCACCCGCTCGCCCTGGGGG + Intergenic
901476807 1:9495408-9495430 GGCGCTGCTGCGCCCCCTGGTGG - Intergenic
902639087 1:17755269-17755291 GGCTCCCCAGCGCCCTCTACTGG - Intergenic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
903026045 1:20430586-20430608 GGCGCCCCAGCGCCCTCTAGTGG + Intergenic
903868758 1:26417199-26417221 GGCTGAGCAGCGCCATCTGGTGG + Intronic
903893235 1:26584306-26584328 AGCTCATCAGCACCCCCAGGAGG - Intergenic
904378278 1:30095272-30095294 GGCTCCCCAGCCCCTCATGGTGG + Intergenic
904617876 1:31759775-31759797 GGGTCATCAGTGCCCCCAGGAGG - Intronic
906640439 1:47437968-47437990 GGCTCCGCAGCGCCCCCTGGCGG - Exonic
911094314 1:94043268-94043290 GGCTCCCCAGTGCACCCAGGAGG - Intronic
913045299 1:115068954-115068976 GGCTTCCCAGCTCCTCCTGGTGG - Intronic
914988700 1:152480248-152480270 GGCTCCTCTCCGCCCCCTGGTGG + Intergenic
915145930 1:153795677-153795699 GGCTCACCAGCCGCCCGTAGCGG - Intergenic
915517071 1:156419927-156419949 TGTTCACCAGCTCCCGCTGGAGG + Intronic
916104614 1:161422155-161422177 GTGTCACCAGCCCTCCCTGGTGG - Intergenic
916714742 1:167439433-167439455 GGCTCCCCTGCGCGCCCTCGCGG - Intronic
917074389 1:171188833-171188855 GACTCTCCAGCACCCCCTAGTGG + Intronic
918222120 1:182444626-182444648 GGCTCTGCAGCACCCCCTGTAGG + Intergenic
920226932 1:204446045-204446067 TGCTCGCCAGCGCCCCCAGCTGG - Exonic
920293612 1:204941903-204941925 TGCTCTCCTGCGCCGCCTGGTGG + Intronic
920298506 1:204974484-204974506 GGCTTGCCAGGGCCACCTGGTGG + Intronic
922423600 1:225475143-225475165 GGCGCTCGAGCGACCCCTGGCGG - Intergenic
924729200 1:246696636-246696658 GTCTCAGCAGCGCCACCTCGTGG + Intergenic
1063301136 10:4849824-4849846 TGCTTCCCAGCGCCACCTGGTGG - Intergenic
1063504078 10:6580365-6580387 GGCTGGCGAGCGCCCCCTGGCGG - Intergenic
1065019989 10:21495848-21495870 GGGGCAGCAGCGCCCCCTGCAGG - Exonic
1065123534 10:22550939-22550961 GGCTCACTGGCGCCCCCCGGTGG - Intronic
1067015232 10:42753331-42753353 GACTCACAAGCGCCGCCTGGAGG - Intergenic
1067084750 10:43231822-43231844 GGCCCACCAGCCCTCCCTGCAGG - Intronic
1067694430 10:48524462-48524484 GGCTCCGTGGCGCCCCCTGGCGG - Intronic
1070326874 10:75395476-75395498 GGCTCTGCAGCGCCGCCTGGTGG + Intergenic
1070918423 10:80169264-80169286 TACCCACCAGTGCCCCCTGGCGG - Exonic
1073110390 10:101060153-101060175 GGGGAACCAGCGCCCTCTGGTGG - Intergenic
1073320825 10:102615453-102615475 GGCTCTGAAGTGCCCCCTGGAGG - Intronic
1074424045 10:113335469-113335491 GACTCACCAGTGCCTCATGGGGG + Intergenic
1076307136 10:129473413-129473435 GGCTCACCACCACCCCATGAAGG + Intronic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076715575 10:132362251-132362273 GGCTCACCAGCTATCCCTGATGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077560892 11:3259984-3260006 GGCCCCCCAGCCACCCCTGGAGG + Intergenic
1077566789 11:3305814-3305836 GGCCCCCCAGCCACCCCTGGAGG + Intergenic
1078090917 11:8263971-8263993 GGCTCCGCAGCGCCACCTGGAGG + Intronic
1083298248 11:61726832-61726854 GGCTCACCAGGGGACGCTGGTGG - Intronic
1083927672 11:65818306-65818328 GGGTCAGCAGCGCCCCCTCCTGG + Intergenic
1083966176 11:66045292-66045314 AGCTGAGCTGCGCCCCCTGGTGG + Exonic
1084814699 11:71639372-71639394 GGCTCTCTAGCGCCCTCTGCTGG - Intergenic
1084891291 11:72238308-72238330 GGCTCACAAGCGCCTCCTTCTGG + Exonic
1085519002 11:77127296-77127318 AGCTCGCCAGCGCCGCCTGCTGG - Intergenic
1085954698 11:81377624-81377646 TCCTCACCAGCGCCCTTTGGTGG + Intergenic
1088107439 11:106223092-106223114 GGCTCAACACCCCCTCCTGGAGG - Intergenic
1088859208 11:113784128-113784150 GGCTCACCTGCTCCTGCTGGTGG + Intergenic
1089590013 11:119534003-119534025 GGCTCTCGGGCTCCCCCTGGAGG + Intergenic
1090152684 11:124402502-124402524 GTGTCACCAGCACCCCCTGGTGG - Intergenic
1091695357 12:2624684-2624706 AGCTCCACAGCGCCCCGTGGTGG + Intronic
1094689508 12:32755274-32755296 GGCTCAGCAGCGTCCCCATGCGG + Exonic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1097268061 12:57756922-57756944 GGCTTAAGAGCTCCCCCTGGAGG - Exonic
1098459775 12:70719990-70720012 GGCGCACAAGCGCCACCTGGAGG + Intronic
1101129077 12:101670220-101670242 TGCTCACCAGCGTACCCTTGTGG - Intronic
1101144830 12:101830970-101830992 GGGTCTCCAGCGCCACCTGGAGG + Intergenic
1101754121 12:107607681-107607703 GTCCCAGCAGCTCCCCCTGGTGG + Intronic
1101789225 12:107912499-107912521 TGCTCCACAGCGCCCCCTGCAGG - Intergenic
1101829492 12:108246308-108246330 GGCTCCCCAGTGCAGCCTGGGGG + Intronic
1103059899 12:117850147-117850169 GGCTCACTGGTTCCCCCTGGTGG + Intronic
1103120860 12:118378078-118378100 GGCTCCACAGCGCCCCCTCGTGG - Intronic
1103985867 12:124767150-124767172 GGACCCACAGCGCCCCCTGGCGG + Intergenic
1104564727 12:129870470-129870492 GGCTCAGCAGAGCTTCCTGGTGG + Intronic
1104973591 12:132542249-132542271 GGCTCAACAGGGCCCCACGGAGG + Intronic
1106482523 13:30147569-30147591 GGCTCCCCAGGGCCCTCTAGGGG - Intergenic
1113647770 13:112011186-112011208 GGCCCACCAGCGTCTGCTGGAGG + Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114070188 14:19099401-19099423 GACTCACACGCGCCGCCTGGAGG + Intergenic
1114092076 14:19300601-19300623 GACTCACACGCGCCGCCTGGAGG - Intergenic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1118904434 14:70013463-70013485 AACTCAGCAGCGCCCACTGGAGG + Exonic
1118980718 14:70714184-70714206 GTCTCATCAGCGCCATCTGGTGG + Intergenic
1119665861 14:76484555-76484577 GGCTCACGAGTGGCGCCTGGTGG + Intronic
1121886391 14:97546720-97546742 GGCTCACCCCCACCGCCTGGCGG - Intergenic
1122145733 14:99687945-99687967 GCCTCCCCAGCGCCCCCTGCAGG + Intronic
1122226979 14:100285824-100285846 GGTGGAGCAGCGCCCCCTGGAGG + Intergenic
1122276047 14:100591325-100591347 GGTTCACCAAGGCCACCTGGGGG + Intergenic
1122544914 14:102516985-102517007 GGCCCGACACCGCCCCCTGGCGG + Intergenic
1122546320 14:102524647-102524669 GGCTTCACAGCGCCCCCTGGTGG - Intergenic
1122894946 14:104752203-104752225 GGCTGCCGAGCGCCCCCGGGCGG - Intergenic
1123142541 14:106095004-106095026 GGTTAATGAGCGCCCCCTGGTGG + Intergenic
1123148055 14:106153539-106153561 GGGTCACGAGCGCCCCCTGGTGG + Intergenic
1123158813 14:106257679-106257701 GGGTCCCTAGCGCCCCCTGGTGG + Intergenic
1123189649 14:106556853-106556875 CGGTCCCTAGCGCCCCCTGGTGG + Intergenic
1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG + Intergenic
1202903240 14_GL000194v1_random:54994-55016 GACTCTCCAGAGCCCGCTGGGGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1123582638 15:21730650-21730672 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123582700 15:21730866-21730888 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1123619288 15:22173246-22173268 GGTTCCTGAGCGCCCCCTGGTGG + Intergenic
1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG + Intergenic
1123997368 15:25728182-25728204 GTCTCACCAGGGACCCCTGCAGG + Intronic
1125159621 15:36627901-36627923 GGCTCAGCAGCTGCCCCTGCCGG + Intronic
1125594164 15:40873790-40873812 GCCGCACCAGCGCCACCTCGGGG + Intronic
1128156674 15:65395859-65395881 GGCTGCCCAGCGCCCCCACGCGG - Exonic
1128304425 15:66588706-66588728 GGCTGACCTGCGCCCCCAAGCGG - Intronic
1128940613 15:71784902-71784924 GGCTCACTGCCTCCCCCTGGTGG - Intergenic
1130022391 15:80242322-80242344 GGCTCACAGGAGCCCCCTTGCGG - Intergenic
1131177582 15:90219725-90219747 GGCTCGGCGGTGCCCCCTGGTGG + Intronic
1131282571 15:91033301-91033323 GGCTCTCCAGCTCCACCTGCAGG + Intergenic
1132253270 15:100350294-100350316 ATCTCACTAGCACCCCCTGGTGG - Intergenic
1132330389 15:101008563-101008585 CGCCCACCGGCGCCCTCTGGAGG + Intronic
1132398467 15:101490330-101490352 GGTTCACCTGCGCGGCCTGGGGG - Intronic
1132398474 15:101490351-101490373 GGTTCACCTGCGCGGCCTGGGGG - Intronic
1132398488 15:101490393-101490415 GGTTCACCTGCGCGGCCTGGGGG - Intronic
1132846540 16:2003446-2003468 GGCTTACCAGGCCCTCCTGGGGG - Intronic
1132892373 16:2210615-2210637 GGCTCTCCAGCCCCCGCAGGAGG + Exonic
1133828180 16:9297675-9297697 GGCACACCAGTGACACCTGGTGG - Intergenic
1135381700 16:22001156-22001178 GGCGGCGCAGCGCCCCCTGGCGG - Intergenic
1135743360 16:24995635-24995657 GGCTCTCCTGCCCACCCTGGTGG - Intronic
1135762549 16:25148781-25148803 GGCTCACAAGCCTCCCCTGCAGG + Intronic
1136275368 16:29176653-29176675 GGCTCATCAGCTCACCCTGCGGG + Intergenic
1136417510 16:30112908-30112930 GGGTGACTGGCGCCCCCTGGAGG - Intronic
1136497482 16:30653040-30653062 GGCCCCCCAGCCCACCCTGGTGG + Exonic
1136570831 16:31095550-31095572 GCCTCACCAGTGCTTCCTGGTGG + Intronic
1136671883 16:31865881-31865903 GGTGCATCAGAGCCCCCTGGGGG + Intergenic
1136872101 16:33816732-33816754 GTGTCCTCAGCGCCCCCTGGTGG - Intergenic
1137877056 16:52006889-52006911 GGCTCCCCACCACCCCCAGGTGG - Intronic
1138122259 16:54410130-54410152 GGCTTCCCCGCGCCTCCTGGAGG - Intergenic
1138537592 16:57668107-57668129 GGCTCAGCAGCTCCCTCTGCAGG + Intergenic
1139391504 16:66608713-66608735 GGAGCACCGGCGCCACCTGGTGG - Intronic
1139528760 16:67531353-67531375 GGCTCACCACAGCGCTCTGGGGG - Intronic
1139684285 16:68590662-68590684 GGCGCATCACCGCCCCCCGGTGG - Intergenic
1141070387 16:80949039-80949061 GGGGCAGCAGCGCCCCCTGGAGG + Intergenic
1141805833 16:86340890-86340912 GGCTCCCCTGCGCCCCCTGGTGG - Intergenic
1142079728 16:88142718-88142740 GGCTCATCAGCTCACCCTGCGGG + Intergenic
1142176335 16:88647094-88647116 GACTCACCAGCGCTCCATGGTGG + Exonic
1203100071 16_KI270728v1_random:1299336-1299358 GTGTCCTCAGCGCCCCCTGGTGG + Intergenic
1142596801 17:1033744-1033766 GCCTCACCAGCACCGCCTGAGGG + Intronic
1142625201 17:1187359-1187381 GGCTCCCCAGCGCCATCTGGCGG + Intronic
1142695146 17:1629194-1629216 GGGCCACCAGCGCCCCCAGCCGG + Intergenic
1142764715 17:2058682-2058704 GGCTCTCCAGCGCCACCTTGGGG - Exonic
1142875325 17:2848961-2848983 GGTACATCAGCGCCCCCTGCTGG - Intronic
1143036924 17:4004787-4004809 GGCTCGGCAGCGCCACCCGGTGG + Exonic
1143625996 17:8110396-8110418 AGGGCACCAGCGCCCCCTGGGGG + Exonic
1145094000 17:20009296-20009318 GGCTCGCGCTCGCCCCCTGGCGG + Intergenic
1145787433 17:27603337-27603359 GGCTCATTAGCGACACCTGGTGG - Intronic
1146185070 17:30719474-30719496 TGCTCACAAGCGCCCTCTGGTGG + Intergenic
1146393560 17:32444310-32444332 AGCTCCCCAGCGCCTCCTAGCGG - Exonic
1147140106 17:38455862-38455884 GGCTCCCCAGGCCCCCATGGGGG + Intronic
1147141185 17:38461426-38461448 TGCTCCCCAGAGGCCCCTGGTGG + Intronic
1147168822 17:38606502-38606524 GGCTCCCCGGCGCCCCCTGCTGG + Intergenic
1147311642 17:39599235-39599257 GGCTCCCCTGCGGCTCCTGGGGG + Intergenic
1147567955 17:41549010-41549032 GGCTTCACAGCGCCTCCTGGGGG + Intergenic
1147587824 17:41662807-41662829 GGAGCAGCAGCGCCCCCTGCCGG + Intergenic
1148108496 17:45132010-45132032 GCCCCGCGAGCGCCCCCTGGTGG + Intronic
1148109210 17:45135417-45135439 GGCGTCCTAGCGCCCCCTGGTGG - Exonic
1148119247 17:45197958-45197980 GGCTCAACAGCGGCACCTGCCGG + Intergenic
1149654341 17:58302404-58302426 GGGTCCCCAGGGCCCCCAGGTGG - Exonic
1151387606 17:73764660-73764682 GGCTCTCCAGCACCCACTGTGGG + Intergenic
1151625075 17:75271267-75271289 GGCTCGCCCGCGCCACCTGCCGG + Intergenic
1151702311 17:75750042-75750064 GGGTCTCTGGCGCCCCCTGGTGG + Intronic
1151932316 17:77240435-77240457 GGCTCACCAGCCTCCCCGGGGGG + Intergenic
1152006980 17:77688497-77688519 GGCCCACCTGCATCCCCTGGGGG - Intergenic
1152236514 17:79141875-79141897 GGCTCTCCAGAGCTCCCTTGGGG - Intronic
1152258612 17:79254638-79254660 GGCTCAGAAGTGGCCCCTGGTGG - Intronic
1152431928 17:80253071-80253093 GGCTCACCAGTGCCACCTGCGGG + Exonic
1156290980 18:35748401-35748423 GGCTTACCACCACCCCCAGGGGG + Intergenic
1158695216 18:59697431-59697453 TGCTCTCCGGCGCCCCCTGCCGG - Intergenic
1160809689 19:1008016-1008038 GGCTCCCCACTGCCCCCAGGAGG - Intronic
1160904306 19:1445338-1445360 GGCTCGCGGGCGCCCGCTGGCGG - Intergenic
1161226116 19:3146764-3146786 TGCTCACAGGCGCCCTCTGGTGG - Intronic
1161241113 19:3224571-3224593 GGCTCCGCAGCGGCCCCTGGCGG - Intergenic
1161258857 19:3324577-3324599 TGCTCACAGGCGCCCTCTGGTGG - Intergenic
1161289447 19:3485167-3485189 TGCTCACAGGTGCCCCCTGGTGG + Intergenic
1161331945 19:3692683-3692705 AGCTCACAGGCACCCCCTGGTGG - Intronic
1161426750 19:4207886-4207908 GGCTCACTATGGCGCCCTGGCGG + Exonic
1161484059 19:4525288-4525310 GGCTCACAGGTGCCCTCTGGTGG + Intronic
1162720308 19:12658111-12658133 GGCCCACCAGCGCCTCCAGCTGG + Exonic
1162951275 19:14073279-14073301 GGCTCCCCAGCGTCCCCCGGAGG + Exonic
1162951339 19:14073531-14073553 GGCGCGCCAGCGCCGCCTGCCGG - Exonic
1162958806 19:14114251-14114273 GGCTCCCTAGCTCCCCCTGCAGG - Intronic
1162973707 19:14196215-14196237 TGCTCACACGCGCCCTCTGGTGG - Intronic
1163625760 19:18388571-18388593 CGCTCTGCGGCGCCCCCTGGCGG - Exonic
1164632279 19:29769449-29769471 AGCTCACAAGTGCACCCTGGGGG - Intergenic
1164692629 19:30222575-30222597 GGCTCTCCGGCTCCCCCTGTCGG - Intergenic
1165317834 19:35067287-35067309 GGGGCAGCAGTGCCCCCTGGTGG - Intergenic
1165406090 19:35632265-35632287 GGCTCCCCAGTGCCCTCAGGAGG + Intronic
1166218755 19:41352632-41352654 GGCACTCCGGCGCCCCCTGGGGG + Intronic
1166539267 19:43594828-43594850 GGCTCTGCAGCGCCGCCCGGAGG + Exonic
1166963419 19:46513628-46513650 GGTCCTGCAGCGCCCCCTGGTGG + Intronic
1167072826 19:47230655-47230677 GGCTCGGCAGCGCCCCCTGGCGG - Intronic
1167098828 19:47391602-47391624 GGCTCTCCAGCGCCCCCTGGAGG + Intergenic
1167150655 19:47707463-47707485 GGTTCCCCAGCACCCTCTGGTGG + Intergenic
1167284081 19:48589052-48589074 GCTTCACCGGCGCCCTCTGGCGG + Intronic
1167607061 19:50487083-50487105 GGACCAACAGCGCCCCCTGCAGG - Exonic
1168255071 19:55160701-55160723 GGCTCTCGCGCGCCCCCAGGCGG + Exonic
1168332327 19:55577965-55577987 GGCTCACCTGCGCGGGCTGGGGG - Exonic
925141206 2:1550872-1550894 GGCTCCGCAGCGCCACCTAGTGG + Intergenic
926124308 2:10262571-10262593 GGCTCTCCAGGCCACCCTGGAGG + Intergenic
926422768 2:12716106-12716128 GACCCAACAGCGCTCCCTGGAGG + Intergenic
927418469 2:22904293-22904315 CCCTTACCTGCGCCCCCTGGAGG - Intergenic
927562609 2:24084458-24084480 GGCACCGCAGCGCCCCCTGCCGG + Exonic
931695175 2:64865723-64865745 GGCGGCGCAGCGCCCCCTGGCGG + Intergenic
933246825 2:79985327-79985349 GCCTCACCAGCTTCCCCTGTAGG + Intronic
933768533 2:85728260-85728282 GGCTCACCATTGCACCCCGGAGG - Intergenic
934503429 2:94875404-94875426 GACTCTCCAGAGCCCACTGGGGG + Intronic
935659637 2:105454969-105454991 GCCTCACAAGCTCCCCCAGGCGG - Intergenic
936569399 2:113602142-113602164 TGGTCGCCAGCGCCCCCTGCTGG - Intergenic
936569932 2:113604188-113604210 TGCTGTCCAGCGCCCCCTGCTGG + Intergenic
938292204 2:130156243-130156265 GTCTCTCCTGCGCCCTCTGGAGG - Intronic
938370835 2:130767469-130767491 CACTGACCAGCGTCCCCTGGTGG - Exonic
938464345 2:131516726-131516748 GTCTCTCCTGCGCCCTCTGGGGG + Intergenic
938891473 2:135710061-135710083 GGACCACCACCGCCACCTGGTGG + Exonic
945025450 2:205615721-205615743 GGCAGACCAGGGCCCCGTGGGGG + Exonic
945977728 2:216283714-216283736 GGCTCAGCAGCTCCCCCTGCAGG + Exonic
946188264 2:217994030-217994052 AGCCCAGCAGTGCCCCCTGGTGG + Intronic
947613865 2:231541730-231541752 TGCTAACTAGCGCCCCCAGGCGG - Intergenic
948321393 2:237072513-237072535 GGTGCCACAGCGCCCCCTGGTGG + Intergenic
948777955 2:240299551-240299573 GAGTCAGCAGCACCCCCTGGAGG - Intergenic
949088831 2:242182153-242182175 TGCTGTCCAGCGCCCCCTGCTGG - Intergenic
1169254278 20:4085411-4085433 GGCTCACAGCTGCCCCCTGGTGG + Intergenic
1171045887 20:21809231-21809253 TGCTCTCTCGCGCCCCCTGGTGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172224948 20:33299289-33299311 GACACACCACCGCCACCTGGCGG + Intronic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1172730330 20:37081881-37081903 GACTCACCAGAGACCCCTGCTGG + Intronic
1172939794 20:38646309-38646331 GGCGCCGCAACGCCCCCTGGTGG - Intronic
1172992287 20:39045518-39045540 TGCTCACCAGTGGCCCCGGGAGG + Intergenic
1173663592 20:44750637-44750659 GGCTCTCGGGCGCCCCCGGGGGG - Exonic
1173821570 20:46023045-46023067 GGCTCGGCAGCGACCCCTGGCGG - Intronic
1174273243 20:49384691-49384713 TGCCCACGAGCGCCCCCTGCAGG - Intronic
1174544968 20:51318394-51318416 CCCACAACAGCGCCCCCTGGAGG + Intergenic
1175238124 20:57526715-57526737 GGTTCCCCAGCGCCCCCTGCAGG - Intergenic
1175341571 20:58234078-58234100 GACTCACCAGCGCCCCCTCTTGG - Intergenic
1175401321 20:58701355-58701377 GGCTCTCCAGGGTGCCCTGGGGG + Intronic
1175913837 20:62416578-62416600 GCCACACCAGCGCCGGCTGGGGG + Intronic
1176622604 21:9069761-9069783 GACTCTCCAGAGCCCGCTGGGGG - Intergenic
1178532369 21:33386282-33386304 TGCTCACTAGCGGCCCCTGAAGG + Intergenic
1179994153 21:44966276-44966298 GGCAGACCTGTGCCCCCTGGGGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180488658 22:15821963-15821985 GACTCACACGCGCCGCCTGGAGG + Intergenic
1181111713 22:20606380-20606402 GTCTCTCCTGCGCCCTCTGGGGG - Intergenic
1181462752 22:23095083-23095105 GGCCCTACAGCGCCCCATGGAGG + Intronic
1181670550 22:24423872-24423894 CGCTCACGGGCGCCCCCTGCAGG - Intronic
1181866024 22:25856001-25856023 GTCTCACCAGGGCCTACTGGAGG - Intronic
1182271202 22:29154611-29154633 TGCTCACCAGCGCCGCCCCGTGG + Intronic
1182461250 22:30485549-30485571 GGCCCAACACTGCCCCCTGGTGG + Intergenic
1182583097 22:31327043-31327065 GGCTCTCGGGGGCCCCCTGGGGG - Exonic
1182667585 22:31970819-31970841 GGCTCCACAGCGCCACCTCGAGG - Intergenic
1183304978 22:37077970-37077992 TGCTCAGGGGCGCCCCCTGGCGG - Intronic
1183948336 22:41339176-41339198 GGCTCACCAGCGAGTCCAGGAGG - Exonic
1184004290 22:41697274-41697296 GGTTCTCTGGCGCCCCCTGGTGG - Exonic
1184112099 22:42401507-42401529 GCCTCCCCAGCACCCCCAGGAGG - Intronic
1184155063 22:42662141-42662163 GGCTCGGGCGCGCCCCCTGGAGG - Intergenic
1184494269 22:44828367-44828389 TTCTCACCAGTGCCCCCAGGAGG - Intronic
1184606634 22:45578179-45578201 GGTCCAACAGCGCCACCTGGAGG - Intronic
1184691875 22:46121102-46121124 GGGTCCCCAGGGTCCCCTGGGGG - Intergenic
1185132419 22:49046714-49046736 GGCTCCCCACCGCCCTCTGGAGG - Intergenic
949355860 3:3179772-3179794 GGGGCCACAGCGCCCCCTGGCGG + Intergenic
950549086 3:13655486-13655508 GGCGCCGCAGCGGCCCCTGGCGG - Intergenic
952816471 3:37452033-37452055 GGCGCGGCAGCGCCCCCTGCGGG - Intergenic
953901414 3:46846037-46846059 GGCCCACTCGCGCCCCCTGCAGG - Intergenic
954386419 3:50246352-50246374 GGCTGCCGGGCGCCCCCTGGTGG + Intronic
954451137 3:50572282-50572304 GGGGCCCCAGTGCCCCCTGGAGG - Intronic
954659894 3:52221435-52221457 GGCCCAGCAGCGCCTGCTGGAGG - Exonic
961441262 3:126954680-126954702 GGCTCACCAGGGCCCCATGAGGG + Intronic
962298181 3:134213083-134213105 GGCTCTCTAGCACCCCCTGGTGG - Intronic
962746559 3:138401318-138401340 AGCTCACCAGCAGCCCTTGGAGG - Intronic
962804197 3:138915556-138915578 CGCCCCACAGCGCCCCCTGGCGG + Intergenic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
968173486 3:196528931-196528953 CGGCCGCCAGCGCCCCCTGGAGG - Intergenic
968572958 4:1352017-1352039 GCCTCTCCCGCGCCCTCTGGTGG + Intronic
969483514 4:7459194-7459216 GACTCGCCAGCGTCCCATGGTGG - Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
972647221 4:40980506-40980528 GGCTCTGCAGTGCCCCCTCGTGG - Intronic
974004731 4:56544698-56544720 TGCCAACCTGCGCCCCCTGGTGG + Intronic
975669916 4:76770664-76770686 GGCTCCCCTTCGCCTCCTGGAGG - Exonic
982583164 4:157204724-157204746 TGAGCACCAGCGCCTCCTGGTGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985466660 4:190203360-190203382 TGCTGTCCAGCGCCCCCTGCTGG - Intergenic
985574835 5:669259-669281 GGCTCACCAGCGCCCCCTGGGGG - Intronic
986123987 5:4868327-4868349 AGCTCATCAGTGCCCCCTGGTGG - Intergenic
986421851 5:7593105-7593127 AGCTGCCCAGCGCCCTCTGGGGG + Intronic
989631249 5:43484398-43484420 GGCTCCTCACCGCCCCCTTGGGG + Intergenic
997395060 5:133553107-133553129 CTCTCTCCCGCGCCCCCTGGAGG - Intronic
997611308 5:135217762-135217784 TCCTCAACAGAGCCCCCTGGAGG + Intronic
997716903 5:136049258-136049280 GGCCCAGCAAGGCCCCCTGGGGG + Intronic
998128440 5:139639193-139639215 GGCTCTCCAGCCCCTCCAGGGGG - Intergenic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
999520914 5:152349840-152349862 GGCTTACCAACGGCCCCTAGTGG + Intergenic
1002094689 5:176823953-176823975 GTCCCACCAGGGCCCCATGGCGG - Intronic
1003235941 6:4295164-4295186 GGCTGAGCAGCACCCACTGGAGG - Intergenic
1003964708 6:11241866-11241888 CGCTCACGAGCGCCAGCTGGCGG - Intronic
1006053974 6:31367057-31367079 AGCGCAGCAGCGCCACCTGGTGG + Intergenic
1006434460 6:34019053-34019075 GGCTCCCCAGGACCCCTTGGAGG + Intronic
1006749322 6:36366698-36366720 GGCTCTCCAGCGGCTCCAGGTGG + Exonic
1009899797 6:69797028-69797050 GACCCACTAGCGTCCCCTGGCGG + Exonic
1014813028 6:125906592-125906614 CCCTCACCAGTGCCCCCTAGAGG - Intronic
1014827680 6:126064994-126065016 GGATCACCAACGCTGCCTGGGGG - Intergenic
1015759586 6:136644327-136644349 AGCTCATCAGCGCCTCCTTGTGG - Intronic
1016989397 6:149918888-149918910 GGCACGCCAGCACCCCCAGGAGG + Intronic
1018899797 6:168045342-168045364 GGCTGACCAGCTCCCACTGTGGG - Intergenic
1019080472 6:169426175-169426197 TGCTCATCAGCGCACGCTGGCGG - Intergenic
1019747723 7:2709865-2709887 GGCCCGCGAGCGCCGCCTGGAGG + Intronic
1020125229 7:5529740-5529762 CGCGCGCCGGCGCCCCCTGGCGG - Intronic
1023831409 7:44040680-44040702 CGCTCAGCAGGGCCCCCAGGTGG + Intergenic
1027270518 7:76516098-76516120 GGCTCACCGGCGACCCCGAGTGG - Intronic
1029640158 7:101815647-101815669 TGCCCTCCAGCGCCCCCTCGGGG + Intergenic
1029741734 7:102494982-102495004 CGCTCAGCAGGGCCCCCAGGTGG + Exonic
1029759725 7:102594151-102594173 CGCTCAGCAGGGCCCCCAGGTGG + Exonic
1029777088 7:102690061-102690083 CGCTCAGCAGGGCCCCCAGGTGG + Intergenic
1032128335 7:129210655-129210677 GGTTCACCGCTGCCCCCTGGTGG + Intronic
1032306051 7:130733540-130733562 GGCGCACCAGCAGCCTCTGGTGG - Exonic
1033233636 7:139621016-139621038 GGGTCACCAGCACCACCTAGGGG + Intronic
1034468937 7:151245617-151245639 GGCCCATGGGCGCCCCCTGGTGG + Exonic
1034957757 7:155345038-155345060 GCCGCACCAGCGCCCCCTGGCGG + Intergenic
1036707466 8:11056045-11056067 TTCTCACCGGCGCCCCCTGCTGG + Intronic
1037487783 8:19364595-19364617 GGCTCACCGGCTGCCTCTGGGGG - Intronic
1037799572 8:22025062-22025084 GGCTCACCGGCAACTCCTGGAGG - Exonic
1041254996 8:55972328-55972350 GTCTCACCAGCGCCACCTTGAGG - Intronic
1045326840 8:101123426-101123448 GGCTAAGCAGCGCCCCCTGGAGG - Intergenic
1046827988 8:118712581-118712603 GTCTCCCCAGCGCCTCCTGCAGG + Intergenic
1049161520 8:141101325-141101347 TGCTCTCCAGCAGCCCCTGGAGG + Intergenic
1051482901 9:17578921-17578943 GGCTCAGCGGCACCCGCTGGCGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG + Intronic
1056949948 9:91033955-91033977 GGATCAGCAGCGCCTCCTGTTGG - Intergenic
1057298347 9:93862150-93862172 AGCCCACCAGCTCCTCCTGGAGG + Intergenic
1057573303 9:96219828-96219850 TGCTCTCCCGCGCCCCCTAGCGG + Intergenic
1057742678 9:97725971-97725993 CCCTCACCAGAGCTCCCTGGTGG - Intergenic
1058915481 9:109560624-109560646 GGCTCACAGGCCCCACCTGGAGG + Intergenic
1060156004 9:121320220-121320242 GGCCCGGCAGCGCCACCTGGTGG - Intronic
1060829079 9:126702617-126702639 CGGGCACCAGCGCCCCCTAGGGG + Intergenic
1061199916 9:129131853-129131875 GGGGCATCAGCTCCCCCTGGTGG - Intronic
1061584225 9:131555754-131555776 GGCTCGCCACCCCTCCCTGGGGG - Intergenic
1061823080 9:133239257-133239279 TGCTCACCAGCGCCCCCAGCTGG - Intergenic
1061838166 9:133342691-133342713 TCCACACCAGCGCCCCCTGGGGG - Intronic
1062183174 9:135202147-135202169 GGCTTACCAGCTCCTTCTGGAGG - Intergenic
1062281722 9:135754873-135754895 GCCTCACAAGCACCTCCTGGGGG + Intronic
1062283046 9:135760412-135760434 GGCACCCCAGCCCACCCTGGAGG + Intronic
1203745796 Un_GL000218v1:40190-40212 GACTCTCCAGAGCCCGCTGGGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203564316 Un_KI270744v1:79292-79314 GACTCTCCAGAGCCCACTGGGGG + Intergenic
1185742872 X:2547846-2547868 GCCTCACCAGCGCAGCATGGTGG + Intergenic
1190381156 X:49840844-49840866 GGCACACCTGCTCCCTCTGGTGG - Intergenic
1192189784 X:68983757-68983779 GGCTCGCCAGGGTCCCCAGGGGG - Intergenic
1197766188 X:130060663-130060685 GGCTCGACAGCGCCACCTGCTGG + Intergenic
1199792977 X:151172226-151172248 GGCTGTCCAGCTCCACCTGGGGG + Intergenic
1200092922 X:153644236-153644258 GCCGGGCCAGCGCCCCCTGGAGG - Intronic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1201159124 Y:11155202-11155224 GACTCTCCAGAGCCCACTGGGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic