ID: 985574970

View in Genome Browser
Species Human (GRCh38)
Location 5:669771-669793
Sequence ACGGGCGGGGAGCTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985574963_985574970 -6 Left 985574963 5:669754-669776 CCGGGTCTCTGCCCCACACGGGC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG No data
985574954_985574970 20 Left 985574954 5:669728-669750 CCCCGAGTGTCTCGGGGAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 66
Right 985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG No data
985574961_985574970 -5 Left 985574961 5:669753-669775 CCCGGGTCTCTGCCCCACACGGG 0: 1
1: 0
2: 0
3: 18
4: 223
Right 985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG No data
985574957_985574970 18 Left 985574957 5:669730-669752 CCGAGTGTCTCGGGGAAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG No data
985574956_985574970 19 Left 985574956 5:669729-669751 CCCGAGTGTCTCGGGGAAAGGGC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 985574970 5:669771-669793 ACGGGCGGGGAGCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985574970 Original CRISPR ACGGGCGGGGAGCTCTCCCC AGG Intronic
No off target data available for this crispr