ID: 985575394

View in Genome Browser
Species Human (GRCh38)
Location 5:671325-671347
Sequence CTTGGGGCCCAGAGGGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 364}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985575389_985575394 -6 Left 985575389 5:671308-671330 CCTTGGTGGGACGTGGACTTGGG 0: 1
1: 0
2: 2
3: 14
4: 118
Right 985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG 0: 1
1: 0
2: 1
3: 38
4: 364
985575380_985575394 22 Left 985575380 5:671280-671302 CCTGTGGACATCACTAGGAAGAG 0: 1
1: 0
2: 0
3: 12
4: 101
Right 985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG 0: 1
1: 0
2: 1
3: 38
4: 364
985575379_985575394 23 Left 985575379 5:671279-671301 CCCTGTGGACATCACTAGGAAGA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG 0: 1
1: 0
2: 1
3: 38
4: 364
985575387_985575394 -5 Left 985575387 5:671307-671329 CCCTTGGTGGGACGTGGACTTGG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG 0: 1
1: 0
2: 1
3: 38
4: 364
985575378_985575394 26 Left 985575378 5:671276-671298 CCGCCCTGTGGACATCACTAGGA 0: 1
1: 0
2: 0
3: 7
4: 120
Right 985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG 0: 1
1: 0
2: 1
3: 38
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985575394 Original CRISPR CTTGGGGCCCAGAGGGACCC CGG Intronic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900291009 1:1923598-1923620 CTGGGGGCCCCGTGGGGCCCTGG + Intronic
900646866 1:3712978-3713000 CTGGGGGCCCTGAGGGTCACAGG - Intronic
900720775 1:4174517-4174539 CTTGGGGCACAGTGGGCACCTGG + Intergenic
901626769 1:10629288-10629310 GTGGGGGCCCGGGGGGACCCTGG + Intronic
901828780 1:11879660-11879682 CCAGGGGCCCAGGGGGCCCCTGG - Intergenic
903170094 1:21547381-21547403 CTTGGGGCAAAGAGGGCCCCTGG - Intronic
903225681 1:21893183-21893205 CGAGGGACCCACAGGGACCCAGG - Intronic
904068411 1:27773340-27773362 GCTGGGGCCCCGAGGGCCCCGGG - Exonic
904374243 1:30069807-30069829 CTTGGGCTCCAGAGAGACTCTGG - Intergenic
904474660 1:30757189-30757211 CCTGGGGCCTGGAGGGAGCCTGG - Intronic
904975059 1:34449581-34449603 CTTGGGGCTCATGGGGACTCAGG + Intergenic
905304522 1:37008207-37008229 CTTGGGGCTCAGAGGGCTCTAGG + Intronic
905621922 1:39455703-39455725 AATGGGGACCAGTGGGACCCTGG - Intronic
905880011 1:41457322-41457344 CAGGGGGCCCAGAGGGTTCCGGG + Intergenic
906746618 1:48226410-48226432 TTTGGGGCGCAGTGGGAACCTGG - Intronic
910258811 1:85276491-85276513 CTTCGGGAACAGAGGGACTCGGG + Exonic
910846842 1:91612119-91612141 CTTGGGCTCCAGAGGGAGTCTGG - Intergenic
912656280 1:111488838-111488860 CATGTGGCCCTGAGGGACACAGG - Exonic
913117006 1:115706487-115706509 CCTGGGAACCAGAGAGACCCTGG + Intronic
914976705 1:152371146-152371168 CTTGAGCCCCAGAGGGGCCAAGG + Intergenic
915633422 1:157169897-157169919 CTTTGGGGCCAGAGTGACCTAGG + Intergenic
915826651 1:159085223-159085245 CTTGCAGCCCAGATGGACACAGG - Intronic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
919919710 1:202160739-202160761 CTTGGGCCCCAGAAGGGCACAGG - Exonic
919977747 1:202623605-202623627 CTTGGGGACCAGCGGGCCCTGGG + Intronic
919990230 1:202704264-202704286 TTTGGGGGCTAGGGGGACCCAGG + Intronic
920785321 1:209035274-209035296 GCTGTGGCCCAAAGGGACCCAGG - Intergenic
922176866 1:223203654-223203676 ATGGGAGCCCAGAGGAACCCAGG + Intergenic
922697304 1:227737081-227737103 GTTGGGGCACAGAGGGATCAGGG + Intronic
922763852 1:228147765-228147787 CTGGGGACCCACAGGGTCCCTGG - Intronic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
924701483 1:246458081-246458103 CTTGGGTCCAAGAGGGGCTCAGG + Intronic
1062768157 10:80828-80850 CTTGTGGCCCAGTGGGTCCTTGG - Intergenic
1062991679 10:1825253-1825275 CCTGGGGCCCTGAGGGACTATGG - Intergenic
1063085958 10:2817947-2817969 CTGGGGGGCCAGGAGGACCCAGG - Intergenic
1063559738 10:7114755-7114777 CTGGGGGCCCACAGTGAGCCAGG - Intergenic
1063959755 10:11297440-11297462 CTTGTGGAACAGAGGGACCAGGG + Intronic
1064035003 10:11907978-11908000 CTTGGGGCCCGGCGGGACAGAGG - Intergenic
1064348638 10:14556591-14556613 CTTGTGGCCTAGATGGACCAGGG - Intronic
1065523416 10:26593976-26593998 CTTGGGGCCCTGCGGGGCCGGGG - Intergenic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067083537 10:43226601-43226623 CCTGGAACCCACAGGGACCCAGG + Intronic
1067278347 10:44853471-44853493 GGTGGGGACCAGAGGGGCCCAGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068137648 10:52965970-52965992 CTCTGGGTCCAGAGGGAGCCAGG - Intergenic
1068386151 10:56330369-56330391 CTTGGGTGCTAGAGGGACCACGG - Intergenic
1070697603 10:78574427-78574449 CTAGGAGCCAAGAGGAACCCTGG + Intergenic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1070811279 10:79299254-79299276 CTTGGGCCCGAGTGGGGCCCTGG + Intronic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1075407769 10:122206037-122206059 CTTGGCGCCCAGAGGGCCAGAGG - Intronic
1075504377 10:123009096-123009118 CTGGGGGCCCAGGGCGACCTTGG + Intronic
1075546924 10:123362160-123362182 CTTGTGTCCCAGAGGGAGCTTGG + Intergenic
1075705505 10:124497836-124497858 CTAGGGGACCTGAGTGACCCGGG + Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076387033 10:130064806-130064828 GTTGGGGGCCGGAGGGGCCCTGG - Intergenic
1076545074 10:131239831-131239853 CTAGGGGCCATGAGGGAGCCTGG - Intronic
1077042653 11:531377-531399 CTGGGGGCCCACAGCGCCCCTGG - Intergenic
1077155665 11:1089806-1089828 TTTGGGGCCCTGTGGGACCCGGG + Intergenic
1077178860 11:1203404-1203426 CTTGAGGGCAAGAGGGACTCTGG - Intergenic
1077302472 11:1853681-1853703 CTTGGGGCCCAGCAGGCCTCAGG + Intronic
1077361536 11:2142834-2142856 GGTGTAGCCCAGAGGGACCCGGG + Intronic
1077413148 11:2412804-2412826 CCTCGGGCCCTGAGGGGCCCTGG + Exonic
1077435916 11:2539123-2539145 CTTGCCCCCCAGAGGGACCACGG - Intronic
1077468705 11:2746815-2746837 CTGGGGCCCTAGAGAGACCCTGG + Intronic
1080873453 11:36256970-36256992 CCTGGGGCACAGAGGTGCCCAGG - Intergenic
1081642277 11:44764468-44764490 CTTTGGGCCCAGAGGTGCCAAGG - Exonic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1081805403 11:45887178-45887200 CATGGGGCTTAGAGGGACCTGGG + Intronic
1083207345 11:61160796-61160818 CTTTGCGCCCAGAGGGTCCCGGG + Intronic
1083227862 11:61295708-61295730 CTGGGTGCCCAGAGGAGCCCGGG - Intergenic
1083684625 11:64368906-64368928 TTCGGGGCCCAAAGGGACCAGGG + Intronic
1084270579 11:68027167-68027189 GGTGGGGGCAAGAGGGACCCAGG - Intronic
1085040810 11:73325241-73325263 CTAGGGGCCCAGAGGGAGACAGG - Intronic
1085200090 11:74696700-74696722 TTTGGAGCCCACAGGGAGCCTGG + Intronic
1085260502 11:75201941-75201963 CTTGGTCACCAGAGGGACCAAGG - Intronic
1085297864 11:75441136-75441158 GTTGGGGGGCAGAGGGCCCCTGG - Intronic
1085785123 11:79441473-79441495 CCTGGGCGCCAGAGAGACCCAGG - Intergenic
1085832702 11:79918391-79918413 CTTGGGGCTCAAAGGAACCTGGG + Intergenic
1089602766 11:119625427-119625449 CGTGGGGCCCAGGGAGACACAGG + Intronic
1094852201 12:34387295-34387317 CTTGGGGCCCAGGGGAACCTGGG - Intergenic
1094855662 12:34401744-34401766 CGTGGGGCCCAGGGGACCCCAGG + Intergenic
1096525975 12:52210733-52210755 CCCAGGGCCCAGAGAGACCCAGG - Intergenic
1097160958 12:57046453-57046475 GTAGGGGCCCAGAGGGAACAGGG + Intronic
1097181699 12:57175380-57175402 CTTGGGGCCCAGCAGGGCCGTGG + Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1100849847 12:98697971-98697993 CCTGGGGTGCACAGGGACCCTGG + Intronic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1102101366 12:110281324-110281346 CGTGCGGCGCTGAGGGACCCGGG + Intronic
1102479099 12:113208634-113208656 CCTGGGGCCCAGGGTCACCCAGG + Intronic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1102955990 12:117059315-117059337 CCGGGGACACAGAGGGACCCGGG - Intronic
1103712610 12:122924018-122924040 CTAGGAGCCCACAGGGACCCTGG - Intronic
1105019794 12:132808403-132808425 CTTAGGCCCCCGAGGGACACTGG + Exonic
1108150358 13:47527406-47527428 CTGGGGGACCTGAGGGACCTGGG - Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1112288714 13:98126226-98126248 CGTGGGGCCCACAGGGAGACTGG - Intergenic
1112579423 13:100665539-100665561 GTGGGGGCCCAGAGGCAGCCAGG - Intronic
1113291065 13:108906752-108906774 CTTGGAGTCCAGAGGGGCCTTGG + Intronic
1113420168 13:110164964-110164986 CTGGGGGGCCAGGAGGACCCGGG + Exonic
1114066431 14:19062704-19062726 CCTGAGGCTCGGAGGGACCCAGG - Intergenic
1114095837 14:19337320-19337342 CCTGAGGCTCGGAGGGACCCAGG + Intergenic
1114267633 14:21082056-21082078 CTAGGGGGCCAGACGGACCCTGG + Exonic
1114634742 14:24181156-24181178 GTGGTGGCCCAGAGGTACCCTGG + Intronic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118973127 14:70654124-70654146 CTTAGGGTCATGAGGGACCCTGG - Intronic
1121053726 14:90836548-90836570 CTTGGCTCCCAGAGGCACCCTGG + Intergenic
1121108562 14:91296527-91296549 CGTGGGGCCCTCAGGGTCCCAGG + Intronic
1121447884 14:93989647-93989669 CTTGGGGGCCCTGGGGACCCAGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122121106 14:99553917-99553939 CTTGGGGGACAGAGGGTCCAGGG + Intronic
1122397109 14:101441548-101441570 GACAGGGCCCAGAGGGACCCGGG - Intergenic
1122985673 14:105210614-105210636 CCTGGGTCCCACAGAGACCCTGG - Intronic
1123107025 14:105846429-105846451 CCTGGGGCCTCCAGGGACCCAGG - Intergenic
1123167728 14:106342576-106342598 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123170354 14:106367287-106367309 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123928796 15:25146654-25146676 CTTGGGGCCAAGAGAGAATCTGG - Intergenic
1124343597 15:28905776-28905798 TTTGGGGCTGAGAAGGACCCTGG + Intronic
1124493393 15:30171969-30171991 CTTGGGGACCAGTGGGCCCTGGG + Intergenic
1124750141 15:32366356-32366378 CTTGGGGACCAGTGGGCCCTGGG - Intergenic
1125579154 15:40773612-40773634 CTTGGGGCCTAGAGTGAGCTTGG - Intronic
1125979806 15:43989844-43989866 CTTGGGGCTCAGGGGGACCTTGG + Intronic
1126012552 15:44316958-44316980 CCTGGGTGACAGAGGGACCCAGG + Intronic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128239574 15:66092768-66092790 CTCAGGGCCCCGGGGGACCCAGG + Intronic
1128648911 15:69396505-69396527 CTTGGGGCCCACAGGGCTGCAGG - Intronic
1129294505 15:74592498-74592520 CTTGGGGACCAGAAGGAAACTGG + Intronic
1129298162 15:74611073-74611095 CTGGGGGGCCACAGGGACCCTGG + Intronic
1129389468 15:75213457-75213479 CTGGGGCCACAGAGGAACCCAGG - Intergenic
1130193788 15:81760581-81760603 CTTGGAGCCCACAGGCATCCTGG - Intergenic
1130564170 15:84980736-84980758 CCTGGGGCCCATGAGGACCCCGG - Intronic
1130967170 15:88705928-88705950 TTCGGGGCCAAGAGGGACCTTGG - Intergenic
1131585613 15:93689761-93689783 CTTGGAGCCTAGAGGGAACAGGG + Intergenic
1132567644 16:630707-630729 CCTGGGGTCCAGAGGGCGCCAGG + Intronic
1132675701 16:1120473-1120495 GCTGGGGCCCAGAGGGGCTCAGG + Intergenic
1132689616 16:1176682-1176704 CTTGGTGCCCAGCCGGCCCCCGG - Intronic
1132814834 16:1820748-1820770 CTTGGGGCCCAGTGGTGCCAAGG - Intronic
1132946551 16:2534746-2534768 CTTGTGGGCCAGAGGCAGCCAGG + Intergenic
1133015250 16:2936747-2936769 CTTTGTCCCCAGAGGGCCCCGGG + Intronic
1133172060 16:3987712-3987734 CTTGGGCTCTAGAGAGACCCTGG - Intronic
1133211222 16:4264321-4264343 CTTGGCTCCCTGTGGGACCCTGG + Intronic
1133220687 16:4317970-4317992 CTTCGGCCCCTGAGTGACCCTGG + Intronic
1133342195 16:5044156-5044178 GTGGGGGCCGGGAGGGACCCAGG - Exonic
1133989404 16:10692870-10692892 CTTGGTGCCAGAAGGGACCCAGG - Intronic
1134021168 16:10922538-10922560 CGTGTGGCCCAGTGTGACCCCGG + Intronic
1134096859 16:11424055-11424077 CTCGGGGGCCAGTGGGTCCCAGG - Intronic
1136100089 16:27987620-27987642 CTTGGGACCCAGAGTGACTGGGG + Intronic
1137563158 16:49515925-49515947 CATGGGGCCGATAGGGCCCCAGG + Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1137726752 16:50661926-50661948 GCTGGGGCCCTGGGGGACCCTGG + Intergenic
1138247135 16:55476230-55476252 CTTGGGGCCTAGAATGGCCCAGG - Intronic
1139853096 16:69962283-69962305 CGTGGGGGAGAGAGGGACCCAGG + Intronic
1139882067 16:70185191-70185213 CGTGGGGGAGAGAGGGACCCAGG + Intronic
1140370442 16:74410314-74410336 CGTGGGGGAGAGAGGGACCCAGG - Intronic
1140947548 16:79784061-79784083 CTTTGGACCCAGAGGGACCAGGG - Intergenic
1141087939 16:81110195-81110217 CCTGAGCCCCAGAGGCACCCTGG - Intergenic
1141625335 16:85258577-85258599 CTTGGGGGGCAGAGGCGCCCTGG - Intergenic
1141630203 16:85283515-85283537 CGAAGGCCCCAGAGGGACCCAGG + Intergenic
1141749764 16:85950503-85950525 CATGGGTTCCTGAGGGACCCAGG - Intergenic
1142192753 16:88725435-88725457 CTTGGGGCCCAGGGTGTCCTGGG + Exonic
1142264782 16:89058649-89058671 CTGTGGGCCAGGAGGGACCCAGG - Intergenic
1142267316 16:89070639-89070661 CTTGCTGCACCGAGGGACCCTGG - Intergenic
1143381344 17:6498196-6498218 TGCGGGGTCCAGAGGGACCCTGG + Intronic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1144736308 17:17557494-17557516 CCTGGGTCCCAGAGCGAGCCAGG - Intronic
1144774398 17:17777754-17777776 ACTGAGGCCCAGAGGGGCCCAGG + Intronic
1147186815 17:38717517-38717539 CCTGGGGCCCCCAGGGACCTCGG + Exonic
1148795607 17:50195267-50195289 CCTGGGGTCCAGAGGGGCCTCGG + Exonic
1148909430 17:50932778-50932800 TCTGGGGCCCACAGGGAGCCTGG - Intergenic
1149444514 17:56703393-56703415 CTTGGGTTCCAGAGGGCCCAGGG + Intergenic
1150267248 17:63839463-63839485 CCTGGGGCCCTGAGTGAGCCAGG - Intronic
1150289380 17:63972797-63972819 CTCAGGGCCCAGAGGCACCAGGG + Exonic
1152287640 17:79422019-79422041 CATGGGGTACAGAGGCACCCAGG + Intronic
1153915638 18:9741908-9741930 CCAGGGACCCAGAGGGAGCCAGG + Intronic
1154071266 18:11153954-11153976 CTTGGGCACCACAGGCACCCAGG + Intergenic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1155546874 18:26924712-26924734 GCTGTGGCACAGAGGGACCCAGG - Intronic
1157619392 18:49007364-49007386 CTTGGGGCTCAGGCTGACCCGGG + Intergenic
1158860001 18:61582425-61582447 GTTGTGGCGCTGAGGGACCCAGG + Intergenic
1160527051 18:79544300-79544322 CATGGGGCCCAAAGGAGCCCAGG - Intergenic
1160584344 18:79904275-79904297 CCTGGGGCTCAGGGGCACCCAGG + Intronic
1161073220 19:2272627-2272649 TCTGGGCCCCAGGGGGACCCTGG + Intronic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1161810181 19:6466970-6466992 CTTGGAGTCCTGAGGGGCCCGGG - Exonic
1162042457 19:7979065-7979087 CTTGGAGCACAGAGGACCCCAGG + Intronic
1162111110 19:8400255-8400277 CTTGGTACCCAGAGATACCCTGG - Intronic
1162320546 19:9968710-9968732 CTGGGAGGCCAGAGGGCCCCTGG + Exonic
1163233667 19:16019395-16019417 CTTGGTGCTGAGAGGGAGCCTGG + Intergenic
1163292086 19:16385485-16385507 ATTGAGACCCAGTGGGACCCAGG - Intronic
1165424629 19:35739087-35739109 CTGGTGGCCCAGAGGCACCTGGG + Exonic
1165476947 19:36036130-36036152 CCTGGGGCACAGAGGGACAGTGG - Intronic
1165484846 19:36089372-36089394 CTTGGGGACCAGAGGAACAGAGG - Intronic
1165825173 19:38701647-38701669 CGTGGGGCCCAGGAGGATCCTGG - Intronic
1165953766 19:39489232-39489254 CATGGGGCTCAGAGGGCCCAGGG + Intronic
1165958193 19:39515193-39515215 CATGGGGCCCAGGGGGACCGGGG - Exonic
1166253404 19:41586225-41586247 CTTGGGCCCCAGGGAGACCCAGG + Intronic
1166384730 19:42374523-42374545 CTTGGTGCCTGGAGTGACCCTGG + Intronic
1166390158 19:42404729-42404751 TTTGTGGCCCAGAGGGTCACTGG + Intronic
1166984670 19:46652693-46652715 CCCGGGGCTCAGAGGGACCCAGG + Exonic
1166995118 19:46716418-46716440 CGGGGGGCCCCGGGGGACCCTGG + Exonic
1167118760 19:47503816-47503838 CTAGGGGCCCACTGGGTCCCAGG + Intronic
1167292337 19:48631076-48631098 ACTGAGGTCCAGAGGGACCCAGG + Intronic
1167297809 19:48662083-48662105 CACGGGACCCAGAGGTACCCTGG - Intronic
1167435369 19:49475720-49475742 CTCGGGACTCAGTGGGACCCAGG + Exonic
1167850384 19:52196805-52196827 CTTGGGGACCTGAGGTAACCTGG - Intronic
1168231449 19:55034920-55034942 GTTGGGGTGCAGAGGGAGCCTGG - Intronic
924978880 2:202251-202273 CTTGGCATCCAGAGGGGCCCAGG - Intergenic
926155671 2:10452597-10452619 CCTGGAGCCCAGAAGGGCCCTGG + Intergenic
927351829 2:22125160-22125182 CTTGGGGGCCAAAGGGTCCCTGG + Intergenic
927883235 2:26703538-26703560 CTTGGGGCCCTGAGGCCCTCTGG + Intronic
929344006 2:40858691-40858713 CTTGGGAACCTGAGGGACACTGG + Intergenic
929932999 2:46273160-46273182 CTTGAGGCCCAGAGGCACATGGG + Intergenic
932619835 2:73258908-73258930 TTTGGACCTCAGAGGGACCCTGG - Exonic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933748716 2:85589393-85589415 CCTGGAGCCAAGATGGACCCAGG - Intronic
935953698 2:108353646-108353668 CTCGGTCCCCAGAGGGACACAGG - Intergenic
935981748 2:108634968-108634990 CTGGGGTCACAGAGGAACCCAGG + Intronic
937443050 2:121933152-121933174 CGTGTGGTCCACAGGGACCCTGG - Intergenic
937863583 2:126731870-126731892 CCTGGGCCCCAGAGCCACCCTGG + Intergenic
937866143 2:126753057-126753079 CGAGGAGACCAGAGGGACCCAGG + Intergenic
938066848 2:128286010-128286032 CCTGGGGCTCAGAGGGGCCAGGG - Intronic
938307731 2:130266407-130266429 CCTGAGGTCCAGATGGACCCTGG - Intergenic
938483824 2:131682837-131682859 CCTGGGGCTCCGAGGGACCCAGG - Intergenic
938943535 2:136190265-136190287 CTTGGGGGACAGAGGGTCCATGG - Intergenic
942246597 2:174013600-174013622 CTTGGGGCCCCGAGGCACAGTGG + Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
946098806 2:217301196-217301218 TTTGGCATCCAGAGGGACCCAGG + Intronic
946173812 2:217910628-217910650 CTTTGGTTCCAGAGGGTCCCGGG - Intronic
946865558 2:224038957-224038979 CTGCGGGGCCAGCGGGACCCTGG - Intronic
948046678 2:234951330-234951352 CCGGGGGCCCAGAGGCGCCCAGG + Intergenic
948149561 2:235734270-235734292 CGTGTGGCCGAAAGGGACCCAGG + Intronic
948590560 2:239047142-239047164 CTGGGCCCCCAGAGGAACCCTGG + Intergenic
948596240 2:239081522-239081544 CTTTCTGCCCAGAGAGACCCAGG - Intronic
948632005 2:239308259-239308281 CTTGGGGACACGAGGGAGCCAGG + Intronic
948808558 2:240463342-240463364 CTCCGGGCCCAGGGGGACCTGGG - Exonic
948947833 2:241230114-241230136 CTTGGAGCCCTGAGGCGCCCTGG - Intronic
949008550 2:241665350-241665372 CAAGGGGCCAAGACGGACCCTGG - Intronic
1172094002 20:32451901-32451923 CTCGGCACCCACAGGGACCCTGG + Intronic
1172447760 20:35002063-35002085 CTTGGGGCCCAGGGCGTCCCGGG - Exonic
1172656568 20:36541737-36541759 CTGGGGGCCGACAGGGACTCTGG + Intronic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1174407323 20:50310673-50310695 CTGGGGGCCCAGCGGCAGCCAGG + Intergenic
1174536000 20:51251851-51251873 CTGTGGCCCCAGAGAGACCCAGG - Intergenic
1174705147 20:52647514-52647536 CATGGGGCCCAGAGTGCCCAGGG + Intergenic
1175265660 20:57701985-57702007 TTTGGGGCCCAGGAGCACCCTGG - Intronic
1175284946 20:57831631-57831653 TTTGGGGCCGAGGGGAACCCTGG - Intergenic
1175481249 20:59312798-59312820 GTTTGGAGCCAGAGGGACCCTGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175899329 20:62353841-62353863 CTGGGGGCTCAGTGGGCCCCTGG - Intronic
1175920708 20:62449399-62449421 CTCCGAGCCCAGAGGCACCCAGG + Intergenic
1176046785 20:63097010-63097032 TTTGGGGCCAACAGGGGCCCTGG - Intergenic
1176056594 20:63152241-63152263 CTTGGGACCAAGATGGAGCCAGG + Intergenic
1178399536 21:32273391-32273413 ATTGGGGGCCAGAAGGACCAAGG - Intronic
1179961668 21:44770903-44770925 CATGGGGCCCACAGGGAACCAGG + Exonic
1180080845 21:45486947-45486969 CTGGGGGCCCAGGGGGCCCAGGG - Exonic
1180109491 21:45641555-45641577 GCAGGGGGCCAGAGGGACCCAGG - Intergenic
1180147373 21:45928909-45928931 CCTGGGGCTCAGGAGGACCCTGG - Intronic
1180484909 22:15785295-15785317 CCTGAGGCTCGGAGGGACCCAGG - Intergenic
1180883399 22:19222636-19222658 ACTGGGGCCCAGAGGCAGCCGGG + Intronic
1181286902 22:21758990-21759012 CATGGGGCCGAGATGGACACAGG - Exonic
1181397610 22:22633062-22633084 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181440346 22:22932391-22932413 CTTGGAGCTCAGAGGGGCCTGGG + Intergenic
1181499129 22:23305837-23305859 CTTGCAACCCAGGGGGACCCTGG + Intronic
1181500358 22:23312432-23312454 CTGGGGGCCCAGAATGAACCTGG + Intronic
1181545593 22:23600336-23600358 CTCAGAGCTCAGAGGGACCCAGG - Intergenic
1181651796 22:24262996-24263018 CTGGGGGCCCAGAATGAACCTGG - Intergenic
1181705580 22:24647743-24647765 CTGGGGGCCCAGAATGAACCTGG + Intergenic
1181814714 22:25429563-25429585 CTCAGAGCTCAGAGGGACCCAGG + Intergenic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1183309335 22:37101022-37101044 GTTGGGGGGCAGAGGGAGCCAGG + Intronic
1183458576 22:37936138-37936160 CTAGGGCCCCAGTGGGCCCCTGG + Intronic
1183733690 22:39631949-39631971 CCTGGGGCCCAGGGAGTCCCAGG - Intronic
1184664330 22:45979187-45979209 CTCGGAGCGCAGAGGGACCGCGG + Intergenic
1184834831 22:47014932-47014954 CTTGGGGCCCTCAGTCACCCAGG - Intronic
1185254660 22:49825688-49825710 CTCGGGGCCCAGGGGGATCAGGG + Intronic
1185278373 22:49959646-49959668 GTTGGGGGCCAGAGGGCCCAGGG - Intergenic
950393780 3:12718163-12718185 CTTGGGGGGCTGAGGGAACCCGG - Intergenic
950442079 3:13016075-13016097 CTTGGGCCCAAAGGGGACCCAGG + Intronic
950640569 3:14345765-14345787 CCTGGGGCCCAGACTGACCTTGG - Intergenic
951906833 3:27714824-27714846 CTCGGGCCCCAGAGGGACGGAGG + Intergenic
952857425 3:37783882-37783904 CCTGGGGCACACAGGGACCCTGG - Intronic
953173044 3:40524924-40524946 CCGGGGGCCTAGAGGGACCCTGG + Exonic
953696579 3:45164688-45164710 CCTGGGTCCCATATGGACCCAGG - Intergenic
954213065 3:49109101-49109123 CTTGGGGCCCCCAGGGACCCAGG + Exonic
954223893 3:49170903-49170925 CTTGGGTCCCAGAGTAGCCCAGG + Intergenic
954632539 3:52055278-52055300 CTGGGGGTCCCGAGAGACCCGGG + Intronic
954798666 3:53174613-53174635 CTTGTGGCTCAGAGAGGCCCAGG + Intronic
955277106 3:57556903-57556925 TTTGGGGCACACAGGGAACCCGG - Exonic
955392481 3:58531607-58531629 CTGGGGCCCCAGAGGGCCACAGG - Intronic
959869157 3:111306745-111306767 CTTGTGGCCAAGGGGGTCCCAGG + Intronic
961734004 3:128989259-128989281 CTTAGGGCCAGGAGGGACCAGGG - Intronic
962808721 3:138944988-138945010 GTTGGGACCCAGCGGGAGCCGGG - Exonic
967559471 3:190901425-190901447 GTTGTGGCTCAAAGGGACCCAGG + Intergenic
968066413 3:195761943-195761965 CTTGGGGCACAGAGCGGGCCGGG - Intronic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
968787412 4:2632922-2632944 CCTGGTGCCCAGAGAGACTCTGG + Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969307564 4:6334643-6334665 CCTGGGCCACAGAGAGACCCAGG + Intronic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
969574579 4:8029623-8029645 CTGGGGGCTCAGAGGAACCAGGG + Intronic
970419430 4:15891505-15891527 ACAGGGGCTCAGAGGGACCCAGG - Intergenic
971026629 4:22595126-22595148 GCTGTGGCACAGAGGGACCCAGG - Intergenic
981761306 4:148198505-148198527 ATTGAGACCCAGATGGACCCTGG - Intronic
983976168 4:173936918-173936940 CTTTGGGCCTAGAGGGAACTTGG - Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
986372528 5:7094058-7094080 GTGGGGTCCCAGTGGGACCCAGG - Intergenic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
987060479 5:14238484-14238506 CACGGGGCCCACAGGGACCCAGG - Intronic
989100905 5:37822165-37822187 TTTGAGGCTCAGAGGGACCCAGG + Intronic
992105836 5:73448409-73448431 GCTGGGGCGCAGAGGGAGCCCGG - Intergenic
994658766 5:102627777-102627799 CATGGGGCTCAGATGGAACCTGG - Intergenic
998412796 5:141923992-141924014 TTTGCGGCCCAGAGTGACGCTGG - Intronic
1000020344 5:157312749-157312771 CTTGTGGCCCACAGGGACCAAGG + Intronic
1000830310 5:166093915-166093937 GCTGGGGCTCAAAGGGACCCAGG - Intergenic
1001277350 5:170360306-170360328 CTCTGGACCCAGAGGGACCTGGG + Intronic
1001522334 5:172403472-172403494 CCTGGGGCCCAGCGGGGTCCTGG + Intronic
1001639459 5:173234695-173234717 CTTGGGGACGAAAGCGACCCAGG + Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1003567145 6:7231045-7231067 TTTGGGGCCCAGCGGAATCCTGG + Exonic
1005980507 6:30832905-30832927 CTTGTGGACCAGAGGAACCAGGG - Intergenic
1006296521 6:33172351-33172373 CTGGGGCCCCAGGGGGACCAGGG + Exonic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006303661 6:33207072-33207094 CTTGGGGACCATAAGAACCCAGG - Intergenic
1006425907 6:33962894-33962916 CGTGGAGCCTAGAGGGCCCCTGG - Intergenic
1006509635 6:34515047-34515069 CTTGGTGCCCACACGGGCCCAGG + Intronic
1006644877 6:35509186-35509208 GTTGGGGCCCAGAGGGGCAGGGG - Intronic
1007485162 6:42175821-42175843 CTGGGGGCAGAGAGGGTCCCAGG - Intronic
1009413812 6:63395025-63395047 CTTGGAGTCCTGAGGGACCCAGG - Intergenic
1016199832 6:141394396-141394418 CCTGGGGCTCAGAGGCACCCCGG - Intergenic
1017605795 6:156131453-156131475 CTTGGGCCACAGGGTGACCCTGG - Intergenic
1018765669 6:166931391-166931413 CTCGGGGCCCAGAAAGACACTGG - Intronic
1019142352 6:169956859-169956881 CCAGGTGCCCAGCGGGACCCCGG + Intergenic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1019554631 7:1622745-1622767 CAAGGGTCCCAGAGGGGCCCAGG + Intergenic
1019588384 7:1816666-1816688 CTGGGGGCCCAGGGGGAGTCTGG + Intronic
1019652656 7:2168816-2168838 CGTGGGGCCCAGAGGCCACCGGG + Intronic
1020139542 7:5605122-5605144 CGTGCGGGCCATAGGGACCCTGG + Intronic
1020789376 7:12607139-12607161 CTTTGGGCCAAGGGTGACCCTGG - Intronic
1022236471 7:28466758-28466780 CTTGGGGCTCAGAGAGACTCAGG - Intronic
1023722360 7:43110073-43110095 CTCGAGGCCCAGGAGGACCCAGG - Intergenic
1026568372 7:71508699-71508721 TGTGGGGGCCAAAGGGACCCTGG + Intronic
1028754175 7:94416464-94416486 CTGGGGGTCCAGAAGGACCTCGG - Exonic
1029525260 7:101089957-101089979 CTTGGGGCCAAGAAGGGCCCAGG + Exonic
1029597876 7:101547217-101547239 CTGGTGGACCAGGGGGACCCCGG - Exonic
1030659848 7:112206915-112206937 CGTGGGGCCCAGTCGAACCCAGG - Intronic
1031478650 7:122252140-122252162 CTTGGGGTCAGGAGGGACCTGGG + Intergenic
1032084896 7:128878778-128878800 CCTGGGGCCATGATGGACCCTGG - Intronic
1034546456 7:151792894-151792916 CTTGTGGGCCTGAGGGACACGGG - Intronic
1034902151 7:154914373-154914395 CTTTGGTTCCAGCGGGACCCAGG + Intergenic
1035171109 7:157017976-157017998 CCGGGGGCCCAGATGCACCCAGG - Intergenic
1035355663 7:158274701-158274723 TGTGGGGCCCAGAGGGGCTCAGG + Intronic
1035614036 8:989229-989251 CTGGGAACCCAGAGGGACTCCGG - Intergenic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1038186393 8:25278693-25278715 CTGAGGACCCAGAGTGACCCTGG - Intronic
1038389343 8:27180481-27180503 CCTGGGGACCTGAAGGACCCAGG + Intergenic
1041151810 8:54943417-54943439 CTTGGGGCCAAGTGAGACCTGGG - Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1043012732 8:74900834-74900856 CCTGAGGGCCAAAGGGACCCTGG + Intergenic
1043827676 8:84948901-84948923 CTTGGGGTTCAGGGGGACCTTGG - Intergenic
1047413252 8:124641410-124641432 ATTGAGGCTCAGAGAGACCCTGG - Intronic
1049300545 8:141867242-141867264 GTTGTGGCCCAGAGGGGGCCAGG + Intergenic
1049381498 8:142318635-142318657 CTGGGGGCCGAGAAGGAGCCAGG + Intronic
1049448134 8:142641087-142641109 CTTGGAGCCCACAGAGTCCCTGG + Intergenic
1049480036 8:142818261-142818283 GATGGGGGCAAGAGGGACCCGGG + Intergenic
1053172185 9:35896042-35896064 CTTTGGGGCCAGAAGGAACCAGG + Intergenic
1053476436 9:38385296-38385318 CCTGGGACCCAGAGAGGCCCAGG + Intergenic
1056763200 9:89428896-89428918 CCAGGGGCCCTGAGGGACCCAGG - Intronic
1057314411 9:93959291-93959313 CTAGGGGCCCAGGCGGCCCCGGG + Intergenic
1059317363 9:113437525-113437547 CTTGGGCCTGAGAGTGACCCAGG + Intergenic
1059324513 9:113496138-113496160 CTTGGGGCCCAGAGCACTCCTGG + Intronic
1059404577 9:114092050-114092072 GTTGGGACCCAGATGGACCTGGG - Intronic
1059433936 9:114265427-114265449 CTGGGGGGCCTGAGGGACCCGGG - Exonic
1059994229 9:119893446-119893468 CTTGGGGCTCAGACTGCCCCAGG + Intergenic
1060558355 9:124521866-124521888 CTGGGGGCCCCGAGGGAGCTGGG + Exonic
1061028689 9:128066970-128066992 CTTGGCGGCCAGGGGTACCCCGG + Exonic
1061032658 9:128095412-128095434 GTGGGGGCCCAGAGGGGCTCTGG - Intronic
1061297674 9:129685846-129685868 CTGAGGGCGCAGAGGGAACCCGG + Intronic
1061396566 9:130346926-130346948 CTAGGGTCCCTGAGGGACCAAGG - Intronic
1061506710 9:131035814-131035836 CTGGGGGCTGAGAGGGACCCAGG - Intronic
1061809500 9:133154135-133154157 GTGGGGACCCAGCGGGACCCCGG + Exonic
1061876611 9:133547231-133547253 CTTGGGGGCCCCAGGGGCCCTGG + Intronic
1061958130 9:133974187-133974209 CTTGCGGCCCAGGAGGACACAGG - Intronic
1062113792 9:134796844-134796866 CTTGGGGTCCATTGGGTCCCTGG - Exonic
1062116575 9:134812610-134812632 CTCGGGGGCCAGGGGGACCCGGG - Exonic
1062146726 9:134993568-134993590 CTTTGGGAGCAGAGGGACTCTGG + Intergenic
1062339708 9:136088543-136088565 CTTGGGGCTCGTGGGGACCCAGG + Intronic
1062370423 9:136236007-136236029 CTTCGGACCCAGAGGGAGACTGG - Intronic
1062446327 9:136596904-136596926 CTGGGGGCCCACTGGGACCTGGG - Intergenic
1062448431 9:136605352-136605374 CTTGGGGCTCACAGGGGCACCGG + Intergenic
1062527482 9:136983863-136983885 CACGGAGTCCAGAGGGACCCAGG + Intronic
1062539768 9:137036366-137036388 CCTGGGGCCCCCAGGGACTCTGG - Exonic
1186752793 X:12639004-12639026 CTTGGAGACCAGAAGAACCCTGG - Intronic
1186763985 X:12752141-12752163 CTTGGGAGCCAGAGAGACCTGGG + Intergenic
1187226247 X:17376950-17376972 CTTGTGGCCCGGAGGGGCCGCGG + Intronic
1189354440 X:40300278-40300300 CCTGAGGCCCAGGCGGACCCTGG - Intergenic
1189957329 X:46288789-46288811 CTTGGGGCTCAGGGGGGCCTCGG + Intergenic
1190069358 X:47266702-47266724 CATGGGTCACAGAGGGACTCAGG - Intergenic
1192035590 X:67559486-67559508 ATTGGGGCCTAGAGGGACGGAGG - Intronic
1197380497 X:125732480-125732502 CACGGGGCCCAGTGGGTCCCTGG - Intergenic
1197804279 X:130384491-130384513 ATTGTGGCCCAGAGAGGCCCAGG - Exonic