ID: 985575599

View in Genome Browser
Species Human (GRCh38)
Location 5:672127-672149
Sequence GGGAACAGTCCGAAGACTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985575595_985575599 8 Left 985575595 5:672096-672118 CCTGGGAGGTGGTTGGGTTGGCT 0: 1
1: 0
2: 0
3: 21
4: 214
Right 985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 81
985575592_985575599 14 Left 985575592 5:672090-672112 CCTGCTCCTGGGAGGTGGTTGGG 0: 1
1: 0
2: 2
3: 41
4: 344
Right 985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 81
985575589_985575599 21 Left 985575589 5:672083-672105 CCTGGGTCCTGCTCCTGGGAGGT 0: 1
1: 1
2: 17
3: 80
4: 381
Right 985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 81
985575585_985575599 26 Left 985575585 5:672078-672100 CCAAACCTGGGTCCTGCTCCTGG 0: 1
1: 0
2: 3
3: 27
4: 343
Right 985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985575599 Original CRISPR GGGAACAGTCCGAAGACTTT AGG Intronic
907083898 1:51651081-51651103 GGGAACACACAGAAGACTCTGGG + Intronic
911055146 1:93702377-93702399 GGGAACAGTCAGGAGACAGTTGG - Intronic
918179561 1:182074647-182074669 GGGAACCGTTCAAAGAGTTTTGG + Intergenic
921146317 1:212361378-212361400 AGGAACAATCTGAAGAATTTTGG - Exonic
922394758 1:225185335-225185357 GACAACAGTCAGAAGAATTTTGG + Intronic
1065625375 10:27624322-27624344 GGGAGCATTCAGAAGAGTTTGGG - Intergenic
1067673833 10:48351467-48351489 GGGTACAATCCCAACACTTTGGG - Intronic
1072382017 10:94882651-94882673 GAGAAAAGTCCTAAGAATTTTGG + Intergenic
1075629506 10:123992384-123992406 GGGAGCGGGCCGAAGACTCTGGG + Intergenic
1078034013 11:7783790-7783812 GGGAAAAGGCCTAAGAATTTTGG + Intergenic
1082661594 11:55919007-55919029 GGGATCATGCAGAAGACTTTGGG - Intergenic
1089336241 11:117725743-117725765 GGGAATTGTCCGGAGGCTTTGGG + Intronic
1093352386 12:18119621-18119643 GGGAACATTCACATGACTTTTGG + Intronic
1097587526 12:61532122-61532144 TGGAACAGTCAGATGAGTTTGGG - Intergenic
1099249645 12:80237476-80237498 GGCAACAGTGAGAAGATTTTAGG + Intronic
1100724267 12:97392399-97392421 GGGCACAGTTTGAAAACTTTGGG + Intergenic
1101807636 12:108078359-108078381 GGGAAAAGTTGGAAGACCTTGGG + Intergenic
1102450577 12:113039079-113039101 GGGCTCAGTGGGAAGACTTTGGG - Intergenic
1103559049 12:121782703-121782725 GGGAGCTGGCTGAAGACTTTTGG - Intronic
1104446736 12:128840217-128840239 GAGAACAGTCCCCAGAGTTTAGG + Intergenic
1106393326 13:29356802-29356824 GGCACCAGTGCTAAGACTTTAGG - Intronic
1107447512 13:40481847-40481869 GGCAACAGTTCTCAGACTTTGGG + Intergenic
1114181524 14:20372086-20372108 GGGCACAGTGCTAAGAATTTTGG - Intronic
1118703532 14:68459226-68459248 GGGAAGGGACAGAAGACTTTGGG + Intronic
1125022563 15:34999684-34999706 GGAAACATTTGGAAGACTTTAGG + Intergenic
1135132716 16:19866184-19866206 GGGCACAGTCCCAGCACTTTGGG - Intronic
1135907539 16:26526838-26526860 GGGCACAGTCCGGTGGCTTTTGG - Intergenic
1136448147 16:30336385-30336407 GGGAACAGACCTAAGATGTTGGG + Intergenic
1140044130 16:71429206-71429228 GGGAACAGTCCTACTTCTTTAGG + Intergenic
1142047725 16:87936443-87936465 GGGAACAGACCCAAGATGTTGGG - Exonic
1142476095 17:191149-191171 GGGAACAGTTCGAAGACCACTGG + Intergenic
1144128437 17:12223427-12223449 GGGAACAATCTGCTGACTTTAGG + Intergenic
1145236630 17:21213514-21213536 GGGAAGATTCTGAAGACTTTTGG - Intronic
1150320806 17:64213037-64213059 GGGAGCAGTCTGAAGGATTTAGG - Exonic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1156090994 18:33469096-33469118 AGGAAAAGTTTGAAGACTTTAGG - Intergenic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1159440079 18:68466956-68466978 GGGAACAGCATGAAGACTTCTGG + Intergenic
1167004510 19:46766873-46766895 GGGAACAGACGGAAGAGGTTGGG + Intronic
928171269 2:29004391-29004413 GGGGACAGTCCACAAACTTTTGG + Intronic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
945264567 2:207878195-207878217 GGGCGCAGTCCTAACACTTTAGG - Intronic
1172388253 20:34548673-34548695 GGGAACACTCCAAAGATTGTAGG - Intronic
1173058588 20:39639928-39639950 GGGAAGAATCTGAAGGCTTTAGG - Intergenic
1176135267 20:63519803-63519825 CGGAACAGTCCGAGGGCTTCGGG - Intergenic
1177502385 21:21974563-21974585 GAGAACACTCTAAAGACTTTAGG + Intergenic
1177958133 21:27626061-27626083 GGGAAAAGTCCCAGGACTCTGGG + Intergenic
950259524 3:11534233-11534255 GGGCACAGTGCTAAGACTCTGGG - Intronic
951702474 3:25510072-25510094 GGCAACAGCCCCAAGACTTCAGG + Intronic
952086220 3:29824991-29825013 AAGAACAGTTTGAAGACTTTGGG - Intronic
954836521 3:53473795-53473817 GGGAAAAGTCCACAGTCTTTGGG + Intergenic
955012204 3:55029084-55029106 GAGAACAGTCTAAAGACTTGTGG - Intronic
955236734 3:57145982-57146004 GCGATCAATCCAAAGACTTTGGG + Intronic
957633842 3:82756295-82756317 GGGAACATTCTGAAGATCTTTGG + Intergenic
958748464 3:98165573-98165595 GGGAATAGTCACAAAACTTTTGG - Intergenic
960041099 3:113150490-113150512 TGAAACAGTCTGAAGATTTTTGG - Intergenic
966242681 3:177772268-177772290 GTGAACATTCAGAAGCCTTTGGG + Intergenic
967389252 3:188939287-188939309 AGCAAAAGTCAGAAGACTTTGGG - Intergenic
967945807 3:194803026-194803048 GAAAAGACTCCGAAGACTTTTGG - Intergenic
975615889 4:76246417-76246439 GGGGAAAGTCTGCAGACTTTAGG + Intronic
976273615 4:83254040-83254062 GGGTACAATCCTAAGAGTTTTGG + Intergenic
984189946 4:176593500-176593522 GGAAACAATCCAAATACTTTGGG + Intergenic
985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG + Intronic
985969523 5:3364108-3364130 TGGAACAGAGAGAAGACTTTTGG + Intergenic
995782480 5:115793140-115793162 GGGCAAAGGCTGAAGACTTTGGG - Intergenic
999273813 5:150314854-150314876 GGCATCAGTCCGAACTCTTTGGG + Intronic
1000890388 5:166795023-166795045 GGGCACATTTCAAAGACTTTTGG + Intergenic
1004677028 6:17853125-17853147 GGGAACAATGCCAGGACTTTGGG - Intronic
1005172332 6:23002292-23002314 GGAAACAATTCCAAGACTTTTGG + Intergenic
1006487178 6:34352775-34352797 GAGGACAGTCAGGAGACTTTGGG + Intronic
1007518161 6:42429810-42429832 GGGAACAGGCTGAAGTGTTTTGG + Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016200703 6:141403718-141403740 AGGGACAGTCTGAAGAATTTTGG + Intergenic
1019806978 7:3134927-3134949 GGCTACAGTCAGAAGACTTGAGG - Intergenic
1023704254 7:42924082-42924104 AGGCACAGTCCCAACACTTTGGG + Intronic
1026788086 7:73314201-73314223 GAGAAAAGGCCTAAGACTTTTGG + Intronic
1035032594 7:155871155-155871177 GGTCACATTCCGAAGTCTTTGGG + Intergenic
1036774476 8:11600774-11600796 GGGAACAGTTGGAGGATTTTTGG + Intergenic
1044170120 8:89040897-89040919 GAGAACATTCCGAAGAATTTTGG - Intergenic
1056367843 9:85923436-85923458 GCGTACAGTCCCAACACTTTGGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193240936 X:79168437-79168459 GGGCACAATCCCAACACTTTGGG + Intergenic
1201055087 Y:9980637-9980659 GGGAATAGTCACAAAACTTTTGG + Intergenic
1202191295 Y:22248787-22248809 GGGAATAGTCACAAAACTTTTGG - Intergenic