ID: 985576220

View in Genome Browser
Species Human (GRCh38)
Location 5:674645-674667
Sequence CACCAGGACCTGCCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 471}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985576209_985576220 15 Left 985576209 5:674607-674629 CCTGCCCATGGCTGGTGACCCAC 0: 1
1: 0
2: 1
3: 24
4: 193
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576214_985576220 -3 Left 985576214 5:674625-674647 CCCACCAGAGCGGCCCTGGTCAC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576211_985576220 10 Left 985576211 5:674612-674634 CCATGGCTGGTGACCCACCAGAG 0: 1
1: 0
2: 3
3: 8
4: 269
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576205_985576220 30 Left 985576205 5:674592-674614 CCCAGGTCACTGCTGCCTGCCCA 0: 1
1: 0
2: 6
3: 54
4: 435
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576206_985576220 29 Left 985576206 5:674593-674615 CCAGGTCACTGCTGCCTGCCCAT 0: 1
1: 0
2: 0
3: 30
4: 345
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576216_985576220 -7 Left 985576216 5:674629-674651 CCAGAGCGGCCCTGGTCACCAGG 0: 1
1: 0
2: 2
3: 22
4: 197
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576215_985576220 -4 Left 985576215 5:674626-674648 CCACCAGAGCGGCCCTGGTCACC 0: 1
1: 0
2: 3
3: 14
4: 176
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471
985576210_985576220 11 Left 985576210 5:674611-674633 CCCATGGCTGGTGACCCACCAGA 0: 1
1: 0
2: 0
3: 11
4: 117
Right 985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 49
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985576220 Original CRISPR CACCAGGACCTGCCAGCAGC TGG Intronic
900910759 1:5595623-5595645 CACCAGGAGCCACCAGAAGCTGG + Intergenic
900926168 1:5707560-5707582 AACCAAGAACTACCAGCAGCAGG + Intergenic
901060157 1:6468165-6468187 TGCCAGCCCCTGCCAGCAGCTGG + Exonic
901063413 1:6484314-6484336 CACCAGCCCCTGGCAGCAGCTGG - Intronic
901183266 1:7356252-7356274 CCCCAGGAACTGCCTGCAGAGGG - Intronic
901230914 1:7641339-7641361 GGCAAGGACCTGCCATCAGCAGG + Intronic
901494979 1:9615614-9615636 CATCAGGAGCTTCCTGCAGCGGG + Intergenic
901735890 1:11311939-11311961 AAACAGGAGCAGCCAGCAGCAGG - Intergenic
902395297 1:16129253-16129275 CACCCAGAGCTGCCAGCTGCTGG + Intronic
902987710 1:20165231-20165253 CCCCAGGATCTGCAAGCAGTGGG + Intronic
903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG + Intronic
904253232 1:29238821-29238843 CCCCAAGCCCTGCCAGCAGGAGG + Intronic
904541827 1:31238812-31238834 CACCAGGAGCTGCCAGATCCTGG - Intronic
905252144 1:36656374-36656396 TTCCAGGACCAGCCAGGAGCTGG - Intergenic
905595984 1:39207843-39207865 CACCACGCCCAGCCAGCATCTGG - Intronic
906157956 1:43625223-43625245 CACCAGTCCTTGCGAGCAGCCGG + Intergenic
907032515 1:51186376-51186398 CACCATGCCCGGCCAGCAGTGGG - Intergenic
907255493 1:53175610-53175632 CTGCAGGACAGGCCAGCAGCTGG - Intergenic
907850484 1:58250329-58250351 CACACGGACCTGCCAGCCCCAGG - Intronic
908723493 1:67150427-67150449 CACCGGGACCTGTCAGAAGGTGG - Intronic
909062127 1:70891197-70891219 GACCATGAGCTTCCAGCAGCAGG + Intronic
909129756 1:71719782-71719804 CACCAGGGCCTGCCAGGGGGTGG - Intronic
910177738 1:84449064-84449086 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
911041220 1:93592436-93592458 CACCAGGCCATGCCAGCTGGAGG + Intronic
911152045 1:94605401-94605423 TACCAGGACCTGGCATCAGTGGG - Intergenic
911166700 1:94730673-94730695 CACCAGGAGCTGCAAGCCACTGG - Intergenic
911645837 1:100336513-100336535 CACAATGGCCTGCCAGCAGTAGG - Intergenic
911690715 1:100830740-100830762 CACTAGGGCCTGTCAGCAGCAGG - Intergenic
911938062 1:104006306-104006328 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
911991222 1:104699111-104699133 CACCAGGACCTGTCAGGGGGTGG + Intergenic
913224538 1:116687342-116687364 CAGCAGGACCTGCCAGCCATTGG - Intergenic
916591385 1:166194380-166194402 CACCAGGGCCTGTCAGCGGGTGG + Intergenic
916687289 1:167158793-167158815 CACCAGAACCTGGAAACAGCAGG - Intergenic
916713658 1:167432915-167432937 CACCAGCTCTTGCCAACAGCTGG - Intronic
917439755 1:175056802-175056824 CACCAGGGCCTGTCAGCAGGTGG - Intergenic
918708930 1:187703718-187703740 CAGCAGGCCCTGCCAGCCCCGGG + Intergenic
919008138 1:191926313-191926335 CACTAGGGCCTGTCAGCAGGTGG - Intergenic
920296255 1:204958943-204958965 CACCAGCCTCTGCCATCAGCAGG - Intronic
920638532 1:207728868-207728890 CACCAGGACTAGACAGTAGCAGG + Intronic
920938459 1:210457864-210457886 CATCAGGACCTCCAAGCAACAGG - Intronic
921207994 1:212865768-212865790 CACCAGGCCCGGCCAGCAATAGG + Intronic
922175722 1:223195568-223195590 CTCCATCAACTGCCAGCAGCAGG - Intergenic
923082169 1:230668385-230668407 CACAGGGACCAGACAGCAGCAGG - Intronic
924082647 1:240415370-240415392 CACCAGGACCTGTCAGAGGGTGG + Intronic
924384217 1:243487638-243487660 CTCCAGAACCTGCGGGCAGCAGG + Intronic
924777376 1:247119472-247119494 CAGCAGGAGCTGCCAGCTGGAGG + Intergenic
1062994788 10:1855762-1855784 CACCAGGGCCTGACAGCACCAGG + Intergenic
1063223798 10:3995323-3995345 CACCGGGACCTGTCAGGGGCTGG - Intergenic
1063535238 10:6876745-6876767 CAGCAGGGCCAGCCAGCAGCCGG + Intergenic
1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG + Intronic
1064933383 10:20652431-20652453 CACCGGGGCCTGTCAGCAGACGG - Intergenic
1066139933 10:32494551-32494573 CACCAGGGCCTGTCAGCAGGTGG - Intronic
1067173969 10:43929610-43929632 TACCAAGACTGGCCAGCAGCTGG - Intergenic
1067431379 10:46248213-46248235 CCCCAGGCCCAGCCAGTAGCAGG + Intergenic
1067687661 10:48476811-48476833 CACCAAGACCTGCACCCAGCAGG - Intronic
1067793652 10:49305654-49305676 CCCATGGACCTGCCACCAGCGGG + Intronic
1068449859 10:57171950-57171972 CACCAGGACCTACCTGCAGGTGG + Intergenic
1068640376 10:59398493-59398515 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
1069258617 10:66365370-66365392 CACCAGGACCTCTCAGGGGCTGG + Intronic
1069770317 10:70894381-70894403 CTCCAGGAGCTACCGGCAGCTGG - Intergenic
1069838849 10:71326780-71326802 CATCTGCACCTGCCAGCAGTTGG - Intronic
1070467042 10:76733897-76733919 CACCAGGGCATGCCAACAGATGG - Intergenic
1071848959 10:89548964-89548986 GAGCAGGACCTGCTCGCAGCAGG + Intronic
1073051983 10:100673114-100673136 CACCAGGAACTGCCATCATTTGG - Intergenic
1075263784 10:120984031-120984053 CACCAGGGCCTGGCAGGAGGGGG - Intergenic
1075814235 10:125252551-125252573 CAGCAGGGCCTGGGAGCAGCAGG - Intergenic
1076030968 10:127157901-127157923 CACAGGCAGCTGCCAGCAGCTGG + Intronic
1076380665 10:130022744-130022766 CTCCAGGACCTGCGTGCAGGAGG - Intergenic
1076381435 10:130026971-130026993 CCCCAGGGCCTGGCAGCAGGTGG - Intergenic
1076470707 10:130716289-130716311 CCAAAGGGCCTGCCAGCAGCTGG + Intergenic
1076508353 10:130993776-130993798 CACCAGGAGCCACCAGAAGCTGG - Intergenic
1077198583 11:1293773-1293795 CACCAGGCCCTGCCAGGAGGTGG + Intronic
1077502149 11:2914286-2914308 CACCACGACCTGCCAGACGCAGG - Intronic
1077517826 11:3012548-3012570 AAGCAGGGCCTGTCAGCAGCTGG - Intronic
1077722873 11:4645321-4645343 CCCCATTACCTGCCTGCAGCAGG + Intronic
1077917987 11:6623311-6623333 CAGCAGCACCCACCAGCAGCCGG + Exonic
1078196288 11:9139646-9139668 TCCCAGCACCAGCCAGCAGCAGG - Exonic
1078868170 11:15318043-15318065 AGCCAGGACCTGCCAGGACCAGG + Intergenic
1079732013 11:23945100-23945122 CCCCAGGAGCTGCCAGAAACTGG - Intergenic
1080725536 11:34896557-34896579 CACCAGGGCCTGTCAGCAGATGG + Intronic
1081538644 11:44014280-44014302 CAGCAGCCCCTGCCCGCAGCTGG - Intergenic
1081634245 11:44710293-44710315 CCCCAGAACCTGCAAGAAGCAGG - Intergenic
1083373124 11:62197425-62197447 CACCAGGGCCTGTCAGGAGTTGG - Intergenic
1084398100 11:68927852-68927874 AACCAGCACCTGCCAGCCCCGGG - Intronic
1084495160 11:69499126-69499148 CTTCAGCACCTGCCAGCGGCAGG + Intergenic
1084937376 11:72594341-72594363 CCTCAGGATCTGGCAGCAGCTGG + Intronic
1085054009 11:73393756-73393778 AACCATGATCTGCCAGCAGAGGG - Intronic
1085175994 11:74488625-74488647 CACCATGCCCAGCCAGAAGCAGG - Intergenic
1085392525 11:76189755-76189777 CACCAGCACCTGCCAGAGCCAGG + Intronic
1085643430 11:78207697-78207719 CCCCAGGACCTGCCTGCATCTGG + Intronic
1085776221 11:79369163-79369185 CTCCTGGCCCTGCCAGCTGCAGG - Intronic
1085841695 11:80018656-80018678 CTCCAGGAGCCGCCAGAAGCTGG - Intergenic
1086295756 11:85365918-85365940 CAACAGGTCCTGCCAGGAGGTGG + Intronic
1086589771 11:88499727-88499749 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
1087398425 11:97633124-97633146 CACCAGGGCCTGTCATGAGCTGG - Intergenic
1087675099 11:101152537-101152559 CACCAGGGCCTGTCAGCGGGTGG - Intergenic
1087779063 11:102284255-102284277 TTCTAGGAACTGCCAGCAGCTGG + Intergenic
1088047488 11:105471668-105471690 CACCAGGGCCTGTCAGCGGGTGG + Intergenic
1088268322 11:108008808-108008830 CGCCAGGTCCCGCCAGCAGAGGG + Exonic
1088593049 11:111419670-111419692 CACCAGCAAGTACCAGCAGCGGG + Intronic
1088593126 11:111420205-111420227 CTCCTGGACAAGCCAGCAGCTGG - Intronic
1088775795 11:113081352-113081374 CTCCAGGACCGGCAAGCACCGGG - Intronic
1090403645 11:126464702-126464724 TGCCAGGAGCTGCCAGGAGCTGG + Intronic
1092038945 12:5366554-5366576 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
1094767457 12:33613274-33613296 CACCAGGGCCTGCCAGGGGGTGG + Intergenic
1096622548 12:52873733-52873755 CAGGTGCACCTGCCAGCAGCTGG + Intergenic
1096766839 12:53898063-53898085 CACCAGGGCCTGCCAGGGGGTGG - Intergenic
1096894440 12:54806779-54806801 CACCAGGACCTGTCAGGGCCTGG - Intergenic
1097737888 12:63202578-63202600 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
1098236286 12:68421530-68421552 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
1099898077 12:88673430-88673452 CACCAGGGCCTGTCAGGTGCTGG + Intergenic
1100119219 12:91348775-91348797 CACCTTGGCCTGCCATCAGCAGG - Intergenic
1100786116 12:98080349-98080371 CACAAGGACCCACCAGAAGCTGG + Intergenic
1100797673 12:98199318-98199340 CACCAGGGCCTGCCAGGGGCTGG - Intergenic
1101182745 12:102237298-102237320 CACCAGGACCTGTCAGGGGGTGG - Intergenic
1101257915 12:102997931-102997953 CACCAGCACATGAAAGCAGCTGG - Intergenic
1101455298 12:104825269-104825291 CACCTGGGCATGCCTGCAGCAGG + Intronic
1102801181 12:115735696-115735718 CACCAGGGCCTGTCAGCGGGTGG + Intergenic
1103913693 12:124365237-124365259 CGACAGGACCTGCCAGCTTCTGG - Intronic
1104083835 12:125457011-125457033 CAGCCAGACCTGCCTGCAGCAGG - Intronic
1104773437 12:131378954-131378976 TACCAGCACCTGACAGGAGCCGG - Intergenic
1105899151 13:24741558-24741580 CACCAGCTGTTGCCAGCAGCTGG + Intergenic
1109540811 13:63776596-63776618 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
1111104685 13:83629771-83629793 CCCCAGGCTCTGCCAGCAGAAGG - Intergenic
1112411415 13:99166758-99166780 CACCAGGGCCTGTCAGAAGGTGG - Intergenic
1113263828 13:108594385-108594407 CACCACGACCTGCGACCTGCAGG - Intergenic
1113778971 13:112965216-112965238 GACCAGGACCTGCTTGCTGCTGG + Intronic
1113902637 13:113805242-113805264 CACCATGCTCTGCCGGCAGCTGG + Intronic
1114497725 14:23145238-23145260 CACCATGCCCGGCCAGAAGCAGG - Intronic
1114671379 14:24413203-24413225 CACCAGCACCTGCCAGGATGTGG + Intronic
1115149080 14:30262472-30262494 CACAAGGACATGACAGCAGGTGG + Intergenic
1115946305 14:38665253-38665275 CACCAGGAGCTGCCAGGAGCTGG - Intergenic
1116142432 14:41015831-41015853 CACCAAGGACTGCCAGCAGGTGG + Intergenic
1116533808 14:46006454-46006476 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1116793275 14:49362565-49362587 CACCAGGGCCTGTCAGCAGGTGG + Intergenic
1118787016 14:69054506-69054528 AACCAGGACCTGCCACCTGAAGG - Exonic
1121208744 14:92190670-92190692 CTCCAGGACCTCTCACCAGCAGG - Intergenic
1121761150 14:96446172-96446194 CAGCAGGACCGGCCCCCAGCAGG - Intronic
1121795606 14:96732859-96732881 CTCCAGGAACCGCCAGAAGCTGG - Intergenic
1121837037 14:97101462-97101484 CACCAGGAGGTTCTAGCAGCAGG - Intergenic
1122813403 14:104300208-104300230 CACCGGGGCCAGCCAGGAGCTGG - Intergenic
1122994693 14:105256732-105256754 CACCAGAACCTCCCAGCCCCAGG + Intronic
1123717399 15:23041827-23041849 CACCAGGACCTCCTGCCAGCTGG - Intergenic
1124144948 15:27116093-27116115 CACCATGGCCTGCCTTCAGCAGG - Intronic
1124383634 15:29188417-29188439 CACCAGGACCTGTCAGGGGGTGG - Intronic
1124474752 15:30023146-30023168 CCCCAGGAAGTGCAAGCAGCCGG - Intergenic
1124495714 15:30185700-30185722 CTGCAGCACCTACCAGCAGCCGG - Intergenic
1124747859 15:32352946-32352968 CTGCAGCACCTACCAGCAGCCGG + Intergenic
1125857929 15:42968677-42968699 CACCAGGGCCTGTCAGGGGCTGG - Intronic
1127296054 15:57609403-57609425 TACCAAGAGCTACCAGCAGCTGG - Intronic
1127467595 15:59259295-59259317 GACCAGGAGATGCCAGCAGGAGG - Intronic
1127751937 15:62054556-62054578 CACCAGGGCCTGTCAGGAGGTGG + Intronic
1128094314 15:64942395-64942417 CCCCAGCACCAGCCTGCAGCTGG + Intronic
1128868859 15:71136975-71136997 CACCAGGAGGAGGCAGCAGCAGG - Intronic
1128968412 15:72085104-72085126 CACCACGCCCGGCCAGCTGCAGG - Intronic
1129202205 15:74009839-74009861 CACCACGCCCAGCCAGAAGCAGG + Intronic
1129551543 15:76455830-76455852 CACCAGGGCCTGTCAGGAGTTGG - Intronic
1130050458 15:80479804-80479826 CATCAGGATCAGCCAACAGCAGG - Intronic
1130892297 15:88143339-88143361 CACCAGGAGCCACCAGAAGCTGG + Intronic
1131146487 15:90017048-90017070 CCTCAGCACCTGGCAGCAGCTGG - Intronic
1131181284 15:90241647-90241669 CTCCAGGACCTCCCAGCTCCTGG + Exonic
1132124783 15:99213386-99213408 CACCAAGCCTTGCCAGCAGATGG - Intronic
1132550865 16:553329-553351 CACCAGGACCTGCCTGGGGGAGG - Exonic
1132604330 16:787461-787483 CTCCAGGTTCTGCCACCAGCTGG - Exonic
1132727363 16:1344819-1344841 CACCCTGACCTTCCGGCAGCTGG + Exonic
1133034554 16:3027571-3027593 CTCCAGGTCCTGACAGCTGCAGG + Exonic
1133235403 16:4385172-4385194 CACCAGGTGCTGACTGCAGCAGG + Intronic
1133302052 16:4788318-4788340 CACCAGGCCCTGCCAGGACAAGG - Exonic
1134116104 16:11550018-11550040 CACCTGGACCTACTAGAAGCTGG + Intronic
1135772956 16:25231293-25231315 CACCAGGAGCCGCCAGGAGCAGG + Intergenic
1136568737 16:31084626-31084648 CCCCAGGAGCTGCATGCAGCCGG + Exonic
1136671735 16:31864686-31864708 CAGCAGGACATGCCAGGGGCTGG - Intergenic
1137046655 16:35670101-35670123 CACCAGGGCCTGCCAGAGGGTGG + Intergenic
1137342232 16:47619801-47619823 CAGCAGAAACTGCAAGCAGCTGG + Intronic
1138152170 16:54669006-54669028 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
1140461370 16:75142404-75142426 CAGCAGGACGTTTCAGCAGCTGG - Intergenic
1140475643 16:75238179-75238201 CACCAGCACCAGCCTGAAGCGGG + Intronic
1140525954 16:75623078-75623100 CGCCTGGAACTGTCAGCAGCCGG - Intronic
1141126619 16:81405054-81405076 CACTGGGGCCTGTCAGCAGCGGG - Intergenic
1141376205 16:83533166-83533188 GACCAGCAGATGCCAGCAGCTGG + Intronic
1141478268 16:84288451-84288473 CCCCAGGACCTGCGAGCATGTGG - Intergenic
1141521073 16:84580048-84580070 CCCAGGCACCTGCCAGCAGCTGG - Intronic
1141575219 16:84959184-84959206 TACCAGGGACTGCCAGCAGGAGG - Intergenic
1141598276 16:85110542-85110564 AAACAGGAGCTGCCACCAGCCGG + Intronic
1141720392 16:85752290-85752312 CCCCAGCACCGGCCAGCGGCAGG - Intergenic
1141739531 16:85881669-85881691 TACCAGCACCTTCCAGAAGCTGG - Intergenic
1141826622 16:86485232-86485254 CACCAGGAGCTGGCAGAGGCAGG + Intergenic
1142003641 16:87678862-87678884 CGCCAGCAGCCGCCAGCAGCTGG + Intronic
1142032900 16:87847260-87847282 CACCAGAACAGCCCAGCAGCTGG + Intronic
1142194273 16:88732400-88732422 CAGCGGCACCCGCCAGCAGCTGG - Exonic
1142686558 17:1580470-1580492 CACCCGGCCCTCCCAGCAGGTGG + Intronic
1142887602 17:2922464-2922486 CACCAGGAACTCCCAGGAGAGGG - Intronic
1143304399 17:5934303-5934325 CACCAGGGCCTGCCAGTGGGTGG - Intronic
1143308603 17:5969749-5969771 CACCAGGGCCTGCCAGGGGGTGG + Intronic
1143779172 17:9220485-9220507 CACCAGGGCCTGCCAGCCCTTGG - Intronic
1144048808 17:11479445-11479467 CACCAGGGCCTGTCAGGAGGTGG + Intronic
1144418467 17:15073636-15073658 CTCCAGGACCTCCCAGATGCTGG - Intergenic
1144774095 17:17775925-17775947 TACCTGGCCCTGGCAGCAGCAGG + Intronic
1145349723 17:22070434-22070456 TCCCAGCACCTGCCACCAGCAGG - Intergenic
1145898308 17:28473717-28473739 CCACAGGGCCTGCCAGCAGGTGG - Exonic
1147320603 17:39643590-39643612 CTCCTGGGCCAGCCAGCAGCAGG + Intronic
1148747818 17:49928139-49928161 CACCAGCCCCTGCCCACAGCGGG - Intergenic
1148806021 17:50264414-50264436 CACCTGAGCCCGCCAGCAGCCGG - Intergenic
1149777165 17:59367041-59367063 CACAGGTACCTGGCAGCAGCCGG - Intronic
1151075491 17:71267498-71267520 CACCAGGACCAGTCAGGAGGTGG + Intergenic
1151402371 17:73864250-73864272 CTGCAGAACCGGCCAGCAGCAGG + Intergenic
1151542506 17:74771709-74771731 CACAAGGCCCAGCCATCAGCAGG + Exonic
1151911136 17:77084028-77084050 CATCAGGAGCTGCCAGCCACAGG + Intergenic
1152397517 17:80043374-80043396 CCCCAGGACCTCTCAGCGGCAGG + Intronic
1152594058 17:81229606-81229628 CCCCAGCCCCTCCCAGCAGCCGG - Intronic
1152613222 17:81325828-81325850 CACCAGCACCTGCCCGACGCCGG + Intronic
1152686614 17:81696824-81696846 CTCCAGGCCATGCCCGCAGCCGG + Exonic
1152764283 17:82127654-82127676 CCCCAGGAGCTGCCCACAGCTGG - Intronic
1153605832 18:6830476-6830498 CACCAGGGCCTGTCAGGGGCTGG - Intronic
1154104230 18:11506245-11506267 CACCATGTCTTGCCAGAAGCAGG + Intergenic
1156455507 18:37291271-37291293 CACTAGGGCCTCCCAGCAGTGGG - Intronic
1157176285 18:45455479-45455501 CACCAGGACCTGTCAGAGGGTGG + Intronic
1157392257 18:47312638-47312660 CCCCAGGTGCTGCCAACAGCAGG + Intergenic
1157901495 18:51522590-51522612 CACCAGGAGCCGCCCGCAGCTGG - Intergenic
1159083485 18:63761085-63761107 CACCAGGCCATGAAAGCAGCTGG + Intronic
1160230545 18:77045376-77045398 CAGCAGCACCTGCCTGCACCAGG + Intronic
1160814160 19:1027691-1027713 CTCCAGGACCTTCCAGCTGGAGG + Intronic
1161400334 19:4064458-4064480 CCTCAGGCCCTGGCAGCAGCAGG + Intronic
1162450044 19:10749075-10749097 GGCCAGGCCCTGCCAGCACCAGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162574241 19:11489619-11489641 CACCATGCCCGGCCAGCAGTTGG + Intronic
1163104733 19:15116677-15116699 CCCCAGAACCTGCCAGAACCAGG + Intronic
1164621471 19:29698103-29698125 CACCTGGACATGCCACCACCTGG + Intergenic
1164949057 19:32321078-32321100 CACCATGTCCTGCCAGTAGCAGG - Intergenic
1164966322 19:32487719-32487741 CATGAGGAGCAGCCAGCAGCAGG + Intergenic
1165153013 19:33771951-33771973 CCCCAGGACCTCCCACCAGGCGG + Exonic
1165323110 19:35098613-35098635 CACCAGGAGCTGTCAGCTGCTGG + Intergenic
1165483873 19:36083570-36083592 CACCAGGACCCTCCTCCAGCTGG - Intronic
1166385122 19:42376439-42376461 CACCGGCCCCTGTCAGCAGCAGG - Exonic
1166558841 19:43718883-43718905 CTCTGGGACCTGCCAGGAGCCGG + Exonic
1166816311 19:45548356-45548378 CAGCAGGGCCTGCCAGGAGATGG + Intronic
1167139361 19:47638941-47638963 CACCATGCCCTGCCAACAGCAGG + Intronic
1168502478 19:56905067-56905089 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1168691247 19:58378886-58378908 CACCCGGAGCCGCCAGAAGCCGG + Intronic
925823818 2:7826778-7826800 CAGCTGGAGCTGCCAGAAGCTGG - Intergenic
926320622 2:11746491-11746513 CAGCAGGCCCTGAAAGCAGCCGG + Intronic
926817984 2:16819607-16819629 CACCAGGACCTGTCAGGGGGTGG - Intergenic
927102743 2:19800375-19800397 CACCAGGAGATCCCAGCTGCGGG + Intergenic
927129476 2:20046184-20046206 CACCAGGGCCTGTCAGCGGGTGG + Intronic
928689494 2:33784484-33784506 CACCAGGAGCCACCAGAAGCTGG + Intergenic
928783210 2:34849835-34849857 CACCTGGAGCTACCAGAAGCTGG + Intergenic
928880942 2:36095791-36095813 CACCAGGGCCTGCCAGTGGCGGG + Intergenic
928904654 2:36356324-36356346 GACCAGGAGGTGCCCGCAGCCGG - Exonic
930729985 2:54719660-54719682 CACCAGGACCTGCCATCATCAGG - Intergenic
931271929 2:60711150-60711172 CACCAGAAGCTGGAAGCAGCAGG - Intergenic
932141416 2:69281456-69281478 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
932376980 2:71245281-71245303 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
932453953 2:71834423-71834445 CAGCAGGCCCAGCCAACAGCTGG - Intergenic
932796908 2:74703816-74703838 CACCAGGAGCTGCCAATAGGAGG + Intergenic
932846117 2:75137435-75137457 CACCATGCCCTGCCGACAGCTGG - Intronic
933335705 2:80956179-80956201 CACCAGGACCTGTCAGGGGGTGG - Intergenic
933789715 2:85873861-85873883 CACCTGGACCTACCACCAGGGGG - Intronic
933798002 2:85936706-85936728 CACCAGAACACGGCAGCAGCTGG - Intergenic
934656499 2:96119160-96119182 GACCAGCAACAGCCAGCAGCAGG + Intergenic
934662196 2:96148950-96148972 GACCAGGACCACCCAGGAGCAGG + Intergenic
934669477 2:96201152-96201174 TACCAGGACATGCTAGGAGCTGG - Intronic
934872360 2:97878682-97878704 CACCAGGGCCTGTCAGGGGCTGG + Intronic
935942779 2:108258730-108258752 AACCAGGACCCGCCAACAACTGG - Exonic
936078543 2:109417186-109417208 CACCAGGCCCTCCCAGCCCCAGG - Intronic
936478205 2:112859752-112859774 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
936837763 2:116728309-116728331 CACAGTGACCTGCCAGCACCTGG - Intergenic
937338653 2:121077124-121077146 AACCTGCACCTGCCAGCAGAGGG + Intergenic
938766560 2:134463861-134463883 ACCCAGGACCTGACGGCAGCAGG + Intronic
939208426 2:139139647-139139669 CACCATGCCCAGCCAACAGCAGG - Intergenic
941477622 2:165968370-165968392 CACCAGCCCGTGACAGCAGCCGG + Intergenic
941682589 2:168414865-168414887 CACCAGCCCCTGAAAGCAGCTGG - Intergenic
942502458 2:176605867-176605889 GACCAGGACCTGTGTGCAGCAGG + Intergenic
946085737 2:217169324-217169346 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
947382901 2:229562650-229562672 CACCAGGCTCTGCCACCAGATGG + Intronic
947579035 2:231300485-231300507 CACCCGGCACTGCCAGCAGGCGG - Intronic
947593123 2:231396111-231396133 CCCCAGGTCTTGCCGGCAGCTGG + Intronic
948286513 2:236790110-236790132 CACCAGGAGCTGGAAGAAGCAGG + Intergenic
948673802 2:239585176-239585198 CTCCAGGAAGGGCCAGCAGCAGG - Exonic
948712408 2:239833347-239833369 CTCCAGGGGCTGCCACCAGCTGG - Intergenic
948807059 2:240457589-240457611 CTCCAGGCCCTGCCTGCAGTGGG + Intronic
948844552 2:240676878-240676900 GACCAGGACCAGGCAGGAGCTGG - Intronic
948849308 2:240698001-240698023 GACCAGGACCAGGCAGGAGCTGG + Intronic
1170177203 20:13484965-13484987 CACCAGGGCCTGTCAGGAGGTGG + Intronic
1170714969 20:18823651-18823673 CACCAGGCCCTGCCCGCAGTAGG - Intronic
1170719921 20:18867580-18867602 CACCAGGGCCTGTCAGGAGATGG - Intergenic
1170940252 20:20842804-20842826 CACCAGGCCATCTCAGCAGCTGG - Intergenic
1170998250 20:21386946-21386968 CACCAGGCCCAGCTAGCATCTGG - Exonic
1171361020 20:24586390-24586412 CACCAGGCCCTGCCAGACCCAGG - Intronic
1173318378 20:41965243-41965265 CACCAGGACCTGTCAGGGGGTGG - Intergenic
1173523599 20:43716262-43716284 CACCAGGAGCCGCCCACAGCTGG - Exonic
1173929462 20:46806700-46806722 CACTAGGAGCTCCCAGCAGCTGG - Intergenic
1174553427 20:51377733-51377755 CACCAGGAACCCCCAGAAGCTGG + Intergenic
1174560144 20:51425348-51425370 CACCAGAAACCGCCAGCAGCAGG - Intronic
1174796793 20:53529021-53529043 CACCAGGAACCACCAGAAGCTGG - Intergenic
1175279620 20:57794385-57794407 CACCATGGCCTGCCTTCAGCAGG - Intergenic
1175794775 20:61764819-61764841 CACCAGCCCCTTCCATCAGCAGG + Intronic
1175907917 20:62390857-62390879 CCCCAGCACCTGCTAGCAGGAGG - Exonic
1175944211 20:62551232-62551254 CTCCAGGCCCTGCCGGCTGCTGG - Intronic
1176179077 20:63741177-63741199 CACCCGGAGCCGCCAGGAGCAGG - Intronic
1176201384 20:63862308-63862330 CACCATGACCTACCCGGAGCTGG + Exonic
1176301958 21:5102705-5102727 GCCCAGGCGCTGCCAGCAGCAGG - Intergenic
1177209382 21:18051084-18051106 CACCAGGTCCTGTCAGGGGCTGG - Intronic
1177349178 21:19912927-19912949 CACCAGGGCCTTTCAGAAGCTGG + Intergenic
1179062437 21:37991383-37991405 CACCAGGACCTGTCGGGAGGTGG + Intronic
1179323664 21:40318488-40318510 CAACTGGCCCTGCCAGCAGAGGG - Intronic
1179541559 21:42086175-42086197 CACAAGCCCCTGTCAGCAGCCGG - Intronic
1179600708 21:42475800-42475822 CACCAAGGCCTGCCTTCAGCTGG - Intronic
1179855072 21:44159195-44159217 GCCCAGGCGCTGCCAGCAGCAGG + Intergenic
1180256303 21:46630959-46630981 CACCAGGACCTGTCAGCGGGTGG - Intergenic
1180958040 22:19749958-19749980 CACCAGGAACTGCCAGGCCCTGG - Intergenic
1181267186 22:21637194-21637216 CACCAGCCCCTGCCAAGAGCAGG + Exonic
1181313940 22:21960138-21960160 CCCCAGGACCTGCCCAGAGCAGG - Intronic
1181772673 22:25137791-25137813 TGCCAGTACCTGCCTGCAGCTGG + Intronic
1181949132 22:26541574-26541596 CACCAGGACCAGGGCGCAGCCGG + Exonic
1182077621 22:27505698-27505720 GACCAGGACCTACCTGCTGCAGG + Intergenic
1182700982 22:32238141-32238163 CACCAGCACCTGCAACAAGCAGG + Intronic
1182797418 22:33000876-33000898 CACCAGGAGCGGCCAGCAGGTGG - Intronic
1182957723 22:34442898-34442920 CACCAGCACATGAAAGCAGCTGG + Intergenic
1183616431 22:38948620-38948642 GACCAGGGCTGGCCAGCAGCGGG - Intergenic
1184264081 22:43337498-43337520 CCTCTGGCCCTGCCAGCAGCCGG + Intronic
1184684139 22:46088359-46088381 CACCAGGACCCAGCAGCAGCTGG - Intronic
1184690947 22:46117012-46117034 CTCCAGGCACTGCCACCAGCAGG + Intergenic
1184850369 22:47116227-47116249 CTCCACCACCTGCCAGGAGCTGG + Intronic
1185063008 22:48616820-48616842 CCCACGGACCTGCAAGCAGCTGG - Intronic
950187370 3:10953451-10953473 ATCCAGGGCCTGGCAGCAGCAGG + Intergenic
950263318 3:11557525-11557547 CGCGAGGGCCTGCCAGGAGCTGG + Exonic
950447559 3:13047127-13047149 CCCAAGGACCAGCCTGCAGCCGG - Intronic
951035931 3:17931827-17931849 CACCAGGAGCCACCAGAAGCTGG - Intronic
951450498 3:22832241-22832263 TACCAGGACCTGTCAGGAGGTGG + Intergenic
952755185 3:36859425-36859447 CACCAGGGCCTGTCAGGAGGTGG - Intronic
953914481 3:46909651-46909673 AAACAGCTCCTGCCAGCAGCGGG - Intergenic
954127475 3:48539895-48539917 CAGGTGGACCTGGCAGCAGCTGG - Intronic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
954371085 3:50169883-50169905 CTCCAAAACCTGCCATCAGCAGG - Intronic
954582850 3:51712386-51712408 CACCAAGACCTGCTAGCTGTGGG + Intronic
954585998 3:51737346-51737368 CACCAGGGCCTGTCAGGGGCAGG - Intergenic
954979129 3:54727742-54727764 CACCAGGGCCTGTCAGTGGCTGG + Intronic
955626177 3:60921994-60922016 CTCCAGGCACTGCCTGCAGCAGG + Intronic
955900199 3:63745450-63745472 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
956034422 3:65075003-65075025 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
956678340 3:71754957-71754979 CACCAGGACCCGCAGGTAGCTGG - Exonic
956704430 3:71987198-71987220 CACCAGAAGCTGGAAGCAGCAGG + Intergenic
958931908 3:100216338-100216360 CACCAGCAGCTGCCCGAAGCTGG - Intergenic
959387319 3:105726709-105726731 CACCAGGGTCTGTCAGCGGCTGG - Intronic
959695106 3:109240921-109240943 CACCAGGGCCTGTCAGCGGTGGG + Intergenic
960062695 3:113340108-113340130 CACCTGGGCATGCCCGCAGCAGG - Intronic
960183400 3:114609776-114609798 CACCAGGATCAGACAGCATCAGG + Intronic
960918939 3:122727016-122727038 CACCATTACCTGCCATCATCTGG - Intronic
961490565 3:127254255-127254277 CACCAGGACCTGCCCCCACGTGG + Intergenic
961651598 3:128419536-128419558 CACCAGGAGCTGCCAGCAAGGGG + Intergenic
962273112 3:133992629-133992651 CCCCAGGCTCTGCCAGCAGAGGG + Intronic
964156855 3:153596104-153596126 CACCAGGACCTGTCAGGGGGTGG - Intergenic
964160709 3:153641425-153641447 CACCAGTACCAGCCTGGAGCTGG + Intergenic
965134843 3:164750600-164750622 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
965216821 3:165874525-165874547 CCCCAGCACCAGCCAGGAGCTGG - Intergenic
965508729 3:169544855-169544877 CACCAGGGCCTGTCAGCAGGTGG + Intronic
966093089 3:176163959-176163981 CACCAGGACCTGTCAGGGGGTGG + Intergenic
966555648 3:181257521-181257543 CACCAGGACCTGGTATCAGTTGG + Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
967255499 3:187587768-187587790 CACCAGGGCCTGTCAGAAGGTGG - Intergenic
967315988 3:188153082-188153104 AACCAGGACCTTCCAGGAACTGG + Intergenic
968634382 4:1670428-1670450 CCCCTGGACCTGGCAGCAGCGGG - Intronic
970387368 4:15569055-15569077 CACCAGGACAAGCCAGCAGAGGG + Intronic
971495168 4:27256496-27256518 CACCGGGGCCTGTCAGCAGGTGG - Intergenic
971881837 4:32384966-32384988 CACCTGGGCCTATCAGCAGCTGG + Intergenic
972191966 4:36604011-36604033 CACCAGGGCCTGTCAGCGGGTGG - Intergenic
974010207 4:56599559-56599581 CACCAGGGCCTGTCAGCGGCAGG - Intronic
975478931 4:74856371-74856393 CACCAGGAGCCACCAGAAGCTGG - Intergenic
977270213 4:94909029-94909051 CACCAGGAGCTACCAGAAGCTGG - Intronic
977666183 4:99649689-99649711 GCCCATGACCTCCCAGCAGCAGG - Exonic
978259543 4:106738171-106738193 CACCAGGAGCTGTCAGGAGAGGG + Intergenic
979012830 4:115393146-115393168 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
979062326 4:116079135-116079157 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
980103856 4:128568060-128568082 CACCTGGACCCACCAGAAGCTGG - Intergenic
980855647 4:138436106-138436128 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
982034661 4:151333897-151333919 GACAAGGACCTACCAGAAGCTGG - Intergenic
982047920 4:151467814-151467836 CACCAGGACCTGTCAGGGGGTGG + Intronic
982619899 4:157691694-157691716 CACCAGGAAGTGCAAGCAGTGGG + Intergenic
984126943 4:175822833-175822855 CACCGGGGCCTGCCAGAGGCTGG - Intronic
984627688 4:182025981-182026003 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
985538671 5:477945-477967 CTCCAGGCCCTGCCATCAGGCGG - Intronic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985658964 5:1146254-1146276 CTCAGGGACCTGCCAGCAGGTGG + Intergenic
986081073 5:4394819-4394841 CACCAGGCCATGCAAGCGGCTGG - Intergenic
986113884 5:4750343-4750365 CACCAGGCCATGAAAGCAGCTGG - Intergenic
986709528 5:10478494-10478516 CACCAGAAGCTGGCAGAAGCAGG - Intergenic
987090838 5:14506817-14506839 CACCTGGCACTGCCGGCAGCCGG + Intronic
987828453 5:23063897-23063919 CACCATGCCCCGCCAGCATCAGG - Intergenic
987873326 5:23647967-23647989 CACCAGCACATGAAAGCAGCTGG + Intergenic
988975709 5:36513999-36514021 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
992686016 5:79200224-79200246 CACCTCAACCTCCCAGCAGCTGG + Intronic
993083899 5:83339459-83339481 CACCAGGGCCTGTCAGGAGATGG + Intronic
994066085 5:95544269-95544291 CAGCAGGCCCTCTCAGCAGCCGG - Intronic
994905704 5:105839120-105839142 CACCAGCTCCTGAAAGCAGCTGG - Intergenic
995106209 5:108380936-108380958 CTCCGGGGCCTGGCAGCAGCCGG + Exonic
995108588 5:108402640-108402662 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
997061726 5:130513292-130513314 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
997075835 5:130675585-130675607 CACCAGGGCCTGTCAGCGGGTGG + Intergenic
997434725 5:133866061-133866083 CACTAGGAGCCACCAGCAGCTGG + Intergenic
997659053 5:135576154-135576176 CACCATCACCTGGCATCAGCAGG - Intronic
997818037 5:137036740-137036762 CAGCAGGAACTGCCTGGAGCAGG - Intronic
998679259 5:144447392-144447414 CACTAGGACCTGTCAGGGGCTGG + Intronic
999152658 5:149436636-149436658 CACCAAGACCTGGCAGAAGGAGG + Intergenic
999179509 5:149659205-149659227 CATCAGGAGCTGCTACCAGCTGG + Intergenic
1000330724 5:160203188-160203210 CACCACGCCCTGCCAGAAGCTGG + Intronic
1000599316 5:163253134-163253156 CACCATGTCCTGCCGGCAGAAGG - Intergenic
1002605227 5:180379114-180379136 CACCTGGAGCTGCCAGAAACTGG - Intergenic
1002642488 5:180636832-180636854 CACCAGGACGGGGCAGCACCGGG - Intronic
1003713046 6:8614746-8614768 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1004881917 6:20017232-20017254 CAAAAGGCCCAGCCAGCAGCAGG + Intergenic
1005221296 6:23591872-23591894 CACCAGGCCCTGCCAACACTGGG - Intergenic
1006615211 6:35321447-35321469 CACCAGGACCTGGCCACAGCTGG + Exonic
1006927372 6:37664489-37664511 CACCCTGAGCTGTCAGCAGCTGG - Intronic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1007815814 6:44524917-44524939 AACCAAGTCCTGCTAGCAGCAGG - Intergenic
1010117741 6:72335235-72335257 CACCGGGGCCTGTCAGCAGGTGG - Intronic
1010466793 6:76176958-76176980 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
1011149639 6:84256358-84256380 CTCCAGGACCTGTCAGTTGCTGG - Intergenic
1011388159 6:86820219-86820241 CACCAGGACCTGTCAGCAGTAGG + Intergenic
1013164944 6:107581293-107581315 CATAAGGATCTGCCAGCAGAAGG + Intronic
1013263851 6:108474039-108474061 CACCAGAGCCTGTCAGGAGCCGG - Intronic
1016713990 6:147203711-147203733 CAGCAGGGCCTCCCAGGAGCCGG - Intergenic
1016773141 6:147874529-147874551 CTCCAGCTCCTGCCACCAGCTGG - Intergenic
1017782406 6:157726054-157726076 CACGAGGAGTGGCCAGCAGCAGG + Intronic
1018610942 6:165647297-165647319 CCCCCGGAGCTGCCAGCGGCAGG + Intronic
1019050417 6:169178958-169178980 CTCCAGGACCTCTCAGCAGGAGG - Intergenic
1019480530 7:1264691-1264713 GAGCAGGACCTGCAGGCAGCTGG - Intergenic
1019882591 7:3875863-3875885 CACCAGGACCTACCAGCTGCAGG - Intronic
1020014744 7:4824405-4824427 CACCAGGACCTTAAGGCAGCCGG + Intronic
1020573889 7:9901283-9901305 CACCAGGACCTGTCAAGAGGTGG - Intergenic
1020655118 7:10920093-10920115 CACCAGGGCCTGACAGTACCTGG - Intergenic
1022217903 7:28282466-28282488 CACCTGGGGCTGCCAGAAGCTGG + Intergenic
1023115042 7:36854654-36854676 CAGCAGGACCTCCCAGGAGAAGG + Exonic
1023795831 7:43791160-43791182 CACCAGGACCTGTCGGGAGGAGG + Intronic
1024528690 7:50372352-50372374 CACCAAATCCTGCCAGCACCTGG + Intronic
1024682476 7:51707407-51707429 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1025139721 7:56452036-56452058 CACCAGGGCCTGCCAGTGGGTGG - Intergenic
1025252142 7:57358746-57358768 AACCAGAACCTGCCAGAAGATGG - Intergenic
1025277861 7:57599880-57599902 TCCCAGCACCTGCCACCAGCAGG + Intergenic
1025755542 7:64335128-64335150 CACCAGGGCCTGTCAGCAGATGG + Intronic
1025819258 7:64947454-64947476 CACCAGGAGCCGCCAGGAGCCGG + Intergenic
1026024198 7:66732071-66732093 CACCAGGCCCTGGCAGAAGCAGG - Intronic
1026888922 7:73970963-73970985 CACCAGGCCCTGGCAGAAGCAGG - Intergenic
1027637644 7:80694959-80694981 CACCAGGACCTGTCAGGGGATGG + Intergenic
1028518742 7:91706241-91706263 CACCAGGACCTGTCAGCCTGGGG + Intronic
1028793144 7:94876078-94876100 CAGCAGGCCCTTTCAGCAGCTGG + Intergenic
1028800860 7:94964491-94964513 CACCAGGGCCTGTCAGCGGGTGG - Intronic
1028926744 7:96365916-96365938 CACCAGGGCCTGTCAGGAGATGG - Intergenic
1029883953 7:103847401-103847423 CACCAGGGCCTGCCAGAGGGTGG + Intronic
1030676422 7:112390504-112390526 GACCAGTACCTGCCAGAACCAGG - Intergenic
1030921962 7:115401877-115401899 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
1031096844 7:117430300-117430322 CACCAGCAACTACCAGAAGCTGG - Intergenic
1031211134 7:118827762-118827784 CACCAGGACCTGTCAGGGGGTGG + Intergenic
1032115861 7:129116603-129116625 CACCAGGGCCTGCCAGTGGGTGG + Intergenic
1032513235 7:132488688-132488710 CTCCAGAACCTGCCAGCTTCCGG + Intronic
1034271932 7:149807350-149807372 CATCAGGATCTGCCAGCAGAGGG + Intergenic
1034478117 7:151300425-151300447 CACCAGGACCCACCAAAAGCGGG - Intergenic
1034534484 7:151718468-151718490 CACCATGACCTGCATGCAGCTGG - Intronic
1035274247 7:157737852-157737874 CACCAGGTCCTCCCCGCATCGGG - Intronic
1035323298 7:158048327-158048349 CACCAGGTCCTGCTAGCCACGGG + Intronic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1035708415 8:1695130-1695152 GACCAGGACCACCCAGCTGCGGG + Intronic
1039641534 8:39228020-39228042 CACCAGTACCAGCCTGGAGCTGG + Intronic
1039718477 8:40136359-40136381 CACCAGGGCCTGTCAGCGGGTGG + Intergenic
1042466176 8:69132234-69132256 CACCAGGACCTGCCAGAGGGTGG + Intergenic
1043081158 8:75766714-75766736 CACCAGGGCCTGTCAGCGGGTGG - Intergenic
1043238024 8:77893674-77893696 CACCAGGGCCTGCCAGGGGGTGG + Intergenic
1043725663 8:83607396-83607418 CACCAGGGCCTGTCAGGAGGTGG + Intergenic
1044767687 8:95594044-95594066 CACCAGGACCTGTCAGGGGTTGG - Intergenic
1045269165 8:100647575-100647597 TACCAGGCTCTGCAAGCAGCTGG + Intronic
1047571929 8:126108525-126108547 CACCAGGACCTGTCAGGGGTTGG + Intergenic
1047573409 8:126127233-126127255 CACCAGGGCCTGTCAGCGGGTGG + Intergenic
1047751606 8:127885146-127885168 CACCAAGACCTGCCAGCCCTGGG - Intergenic
1049350134 8:142159918-142159940 CACCAGAACCACCCAGAAGCAGG + Intergenic
1049587371 8:143438278-143438300 CACCAGGACCTGTTGGCAGCAGG - Intronic
1049807588 8:144547972-144547994 CCCCTCGCCCTGCCAGCAGCTGG - Exonic
1049924309 9:394061-394083 TACCAGGACCTCACTGCAGCAGG + Intronic
1050070114 9:1801581-1801603 CACCAGAACCTTTCAGAAGCTGG - Intergenic
1050130197 9:2403955-2403977 TGCCAGGACTTGCCACCAGCTGG + Intergenic
1050699641 9:8324256-8324278 CACCAGGGCCTGCCAGGGGGTGG - Intronic
1051546299 9:18279876-18279898 CACCAGGACCAGCCTGGTGCTGG + Intergenic
1052124559 9:24759241-24759263 CACCAGGGCCTGTCAGCGGATGG - Intergenic
1053416302 9:37948899-37948921 CCCCAGGACCCGGCAGCAGCAGG - Intronic
1053428690 9:38027727-38027749 CACCAGGAGCTCCCAGGAGTTGG - Intronic
1054459692 9:65456009-65456031 CACCAGGCCCTGTCAGGAACAGG + Intergenic
1055078335 9:72240767-72240789 CACCAGGAGCCACCAGAAGCTGG + Intronic
1055290003 9:74772717-74772739 CACCATGCCCTGCCATCAGTAGG - Intronic
1055829119 9:80359325-80359347 CCCCAAGAGCTGCCAGCAACAGG - Intergenic
1056676443 9:88680499-88680521 CCCCAGGGGCTGCCATCAGCTGG + Intergenic
1056790715 9:89623660-89623682 CAGGAGGTCCTGCCAGAAGCAGG - Intergenic
1057270652 9:93648944-93648966 CAGCAGGAGCTGCCAGGGGCTGG - Intronic
1057320782 9:94010664-94010686 CACCAGGCCCGGCCAGGAGAGGG + Intergenic
1060019374 9:120115980-120116002 AACCAGGATGTCCCAGCAGCTGG + Intergenic
1060496916 9:124125867-124125889 GAGCAGGACCTGCCGGCCGCAGG - Intergenic
1060965439 9:127709981-127710003 CACCACGCCCAGCCAGCAGCTGG - Intronic
1061145742 9:128797337-128797359 CCCCAGGATCTGGCAGCATCAGG - Intronic
1061544617 9:131297254-131297276 CACCAGGTCCTGCTAGGAGCAGG - Intronic
1061718081 9:132533489-132533511 CGCCTGGAGCCGCCAGCAGCTGG - Intronic
1062027293 9:134346488-134346510 CACCAGGTCCTGCCAGTGGCTGG + Intronic
1062073671 9:134572772-134572794 GCCCAGGACCTGCATGCAGCAGG - Intergenic
1062161376 9:135082099-135082121 CAAAAGGACATCCCAGCAGCAGG + Intronic
1062458854 9:136654433-136654455 CACCACGCCCGGCCAGCGGCAGG - Intergenic
1062663076 9:137649784-137649806 GACCACGCCCTGCCAGCAGCCGG + Intronic
1185666860 X:1772445-1772467 CACCATGCCCAGCCAGGAGCAGG - Intergenic
1185722590 X:2394298-2394320 GACCTGGACTTGGCAGCAGCAGG + Intronic
1186748682 X:12598356-12598378 CACCAGGGACTAGCAGCAGCTGG + Intronic
1187555235 X:20344916-20344938 CACCAGTCCATGCAAGCAGCTGG + Intergenic
1189197759 X:39166380-39166402 TACCCAGAGCTGCCAGCAGCAGG - Intergenic
1189986047 X:46554147-46554169 CACCATGGCCTGCCAGCACTTGG + Intergenic
1191653147 X:63563933-63563955 CACCAGGGCCTGCCAGGGGGTGG - Intergenic
1192396429 X:70786304-70786326 CACCAGGGCCTGTCAGGAGGTGG + Intronic
1192588372 X:72339146-72339168 TACCAGAGCCTGCCAGCAGCAGG - Intronic
1193018974 X:76769518-76769540 CACCAGGGCCTGTCAGCGGGTGG - Intergenic
1193028545 X:76872961-76872983 CACCAGGGCCTGTCAGCAGATGG + Intergenic
1193643825 X:84043650-84043672 CCCCAGCACCAGCCAGGAGCTGG - Intergenic
1194420452 X:93666437-93666459 CACCAGGACATGTCAGGAGGTGG + Intergenic
1194514793 X:94839356-94839378 CACCAGGACCTGTCAGGGGGTGG - Intergenic
1195306891 X:103592325-103592347 CACCAGGGCCTGTCAGGAGGTGG - Intergenic
1195549182 X:106147008-106147030 CACCGGGACCTACCAGAAGGTGG + Intergenic
1197023425 X:121717838-121717860 CACCAGGCCATGAAAGCAGCTGG - Intergenic
1197965090 X:132051751-132051773 CACCAGGGCCTGCCAGGGGGTGG - Intergenic
1198531234 X:137550867-137550889 CACGAGCTCCAGCCAGCAGCCGG + Intergenic
1200792548 Y:7312576-7312598 CACCTGGAACTGCCAGCAAAAGG - Intergenic
1201666755 Y:16466210-16466232 CACCAGGGCCTGTCAGTAGTTGG + Intergenic
1201681846 Y:16654780-16654802 CACCAGGTCCTGTCAGGGGCTGG - Intergenic