ID: 985578145

View in Genome Browser
Species Human (GRCh38)
Location 5:683188-683210
Sequence CAGTCTCCTCATCCTTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985578137_985578145 28 Left 985578137 5:683137-683159 CCAGAGCTCGCTCGCAGGCAAGT 0: 1
1: 0
2: 1
3: 3
4: 39
Right 985578145 5:683188-683210 CAGTCTCCTCATCCTTGAAGGGG No data
985578140_985578145 4 Left 985578140 5:683161-683183 CCCATGGTAGGACAGCTGCTTGT 0: 1
1: 0
2: 1
3: 7
4: 93
Right 985578145 5:683188-683210 CAGTCTCCTCATCCTTGAAGGGG No data
985578135_985578145 30 Left 985578135 5:683135-683157 CCCCAGAGCTCGCTCGCAGGCAA 0: 1
1: 0
2: 1
3: 3
4: 78
Right 985578145 5:683188-683210 CAGTCTCCTCATCCTTGAAGGGG No data
985578136_985578145 29 Left 985578136 5:683136-683158 CCCAGAGCTCGCTCGCAGGCAAG 0: 1
1: 0
2: 1
3: 2
4: 43
Right 985578145 5:683188-683210 CAGTCTCCTCATCCTTGAAGGGG No data
985578141_985578145 3 Left 985578141 5:683162-683184 CCATGGTAGGACAGCTGCTTGTG 0: 1
1: 0
2: 1
3: 11
4: 151
Right 985578145 5:683188-683210 CAGTCTCCTCATCCTTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985578145 Original CRISPR CAGTCTCCTCATCCTTGAAG GGG Intronic
No off target data available for this crispr