ID: 985580437

View in Genome Browser
Species Human (GRCh38)
Location 5:693099-693121
Sequence ACTCCGGGCATCCCAATCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 41}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580432_985580437 -10 Left 985580432 5:693086-693108 CCCGCAGCGCCGAACTCCGGGCA 0: 2
1: 0
2: 1
3: 2
4: 60
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580427_985580437 11 Left 985580427 5:693065-693087 CCGTCGCGTCCTCGCACCGAGCC 0: 2
1: 0
2: 0
3: 2
4: 61
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580425_985580437 13 Left 985580425 5:693063-693085 CCCCGTCGCGTCCTCGCACCGAG 0: 2
1: 0
2: 0
3: 0
4: 31
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580426_985580437 12 Left 985580426 5:693064-693086 CCCGTCGCGTCCTCGCACCGAGC 0: 2
1: 0
2: 0
3: 3
4: 49
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580423_985580437 27 Left 985580423 5:693049-693071 CCTTTGCAAAGCCTCCCCGTCGC 0: 2
1: 0
2: 0
3: 5
4: 62
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580429_985580437 -5 Left 985580429 5:693081-693103 CCGAGCCCGCAGCGCCGAACTCC 0: 2
1: 0
2: 1
3: 12
4: 149
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580424_985580437 16 Left 985580424 5:693060-693082 CCTCCCCGTCGCGTCCTCGCACC 0: 2
1: 0
2: 1
3: 3
4: 131
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41
985580428_985580437 2 Left 985580428 5:693074-693096 CCTCGCACCGAGCCCGCAGCGCC 0: 2
1: 0
2: 1
3: 23
4: 251
Right 985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG 0: 2
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580437 Original CRISPR ACTCCGGGCATCCCAATCCG GGG Intronic