ID: 985580731

View in Genome Browser
Species Human (GRCh38)
Location 5:693970-693992
Sequence GCTGCGCTGGGCGCCCGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580731_985580739 7 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580739 5:694000-694022 GAGTGGGCCGCCCTTCACGCAGG No data
985580731_985580738 -9 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580738 5:693984-694006 CAGCGCAGCTGCTCGGGAGTGGG No data
985580731_985580745 20 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data
985580731_985580737 -10 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580737 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
985580731_985580740 12 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580731_985580742 15 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580731 Original CRISPR GCTGCGCTGGGCGCCCGGCA CGG (reversed) Intergenic
No off target data available for this crispr