ID: 985580732

View in Genome Browser
Species Human (GRCh38)
Location 5:693975-693997
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580732_985580742 10 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data
985580732_985580740 7 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580732_985580739 2 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580739 5:694000-694022 GAGTGGGCCGCCCTTCACGCAGG No data
985580732_985580745 15 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580732 Original CRISPR GAGCAGCTGCGCTGGGCGCC CGG (reversed) Intergenic