ID: 985580735

View in Genome Browser
Species Human (GRCh38)
Location 5:693982-694004
Sequence CACTCCCGAGCAGCTGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580735_985580739 -5 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580739 5:694000-694022 GAGTGGGCCGCCCTTCACGCAGG No data
985580735_985580740 0 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580735_985580745 8 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data
985580735_985580746 29 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580735_985580742 3 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580735 Original CRISPR CACTCCCGAGCAGCTGCGCT GGG (reversed) Intergenic