ID: 985580736

View in Genome Browser
Species Human (GRCh38)
Location 5:693983-694005
Sequence CCACTCCCGAGCAGCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580736_985580739 -6 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580739 5:694000-694022 GAGTGGGCCGCCCTTCACGCAGG No data
985580736_985580742 2 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data
985580736_985580740 -1 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580736_985580746 28 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580736_985580745 7 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580736 Original CRISPR CCACTCCCGAGCAGCTGCGC TGG (reversed) Intergenic
No off target data available for this crispr