ID: 985580737

View in Genome Browser
Species Human (GRCh38)
Location 5:693983-694005
Sequence CCAGCGCAGCTGCTCGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580731_985580737 -10 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580737 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
985580728_985580737 9 Left 985580728 5:693951-693973 CCTGAGCAGGGAGACGGGTCCGT No data
Right 985580737 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
985580725_985580737 20 Left 985580725 5:693940-693962 CCGGGGATCGACCTGAGCAGGGA No data
Right 985580737 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580737 Original CRISPR CCAGCGCAGCTGCTCGGGAG TGG Intergenic