ID: 985580740

View in Genome Browser
Species Human (GRCh38)
Location 5:694005-694027
Sequence GGCCGCCCTTCACGCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580736_985580740 -1 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580731_985580740 12 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580732_985580740 7 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data
985580735_985580740 0 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580740 5:694005-694027 GGCCGCCCTTCACGCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580740 Original CRISPR GGCCGCCCTTCACGCAGGAG TGG Intergenic