ID: 985580741

View in Genome Browser
Species Human (GRCh38)
Location 5:694007-694029
Sequence CTCCACTCCTGCGTGAAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580741_985580754 29 Left 985580741 5:694007-694029 CCGCCCTTCACGCAGGAGTGGAG No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data
985580741_985580746 4 Left 985580741 5:694007-694029 CCGCCCTTCACGCAGGAGTGGAG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580741 Original CRISPR CTCCACTCCTGCGTGAAGGG CGG (reversed) Intergenic