ID: 985580742

View in Genome Browser
Species Human (GRCh38)
Location 5:694008-694030
Sequence CGCCCTTCACGCAGGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580736_985580742 2 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data
985580732_985580742 10 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data
985580735_985580742 3 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data
985580731_985580742 15 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580742 Original CRISPR CGCCCTTCACGCAGGAGTGG AGG Intergenic
No off target data available for this crispr