ID: 985580743

View in Genome Browser
Species Human (GRCh38)
Location 5:694010-694032
Sequence CTCCTCCACTCCTGCGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580743_985580746 1 Left 985580743 5:694010-694032 CCCTTCACGCAGGAGTGGAGGAG No data
Right 985580746 5:694034-694056 GGAGCGCGCACCCCTGACCCCGG No data
985580743_985580754 26 Left 985580743 5:694010-694032 CCCTTCACGCAGGAGTGGAGGAG No data
Right 985580754 5:694059-694081 TCAGCTTCCGTTCTCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580743 Original CRISPR CTCCTCCACTCCTGCGTGAA GGG (reversed) Intergenic