ID: 985580745

View in Genome Browser
Species Human (GRCh38)
Location 5:694013-694035
Sequence TTCACGCAGGAGTGGAGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985580735_985580745 8 Left 985580735 5:693982-694004 CCCAGCGCAGCTGCTCGGGAGTG No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data
985580731_985580745 20 Left 985580731 5:693970-693992 CCGTGCCGGGCGCCCAGCGCAGC No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data
985580736_985580745 7 Left 985580736 5:693983-694005 CCAGCGCAGCTGCTCGGGAGTGG No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data
985580732_985580745 15 Left 985580732 5:693975-693997 CCGGGCGCCCAGCGCAGCTGCTC No data
Right 985580745 5:694013-694035 TTCACGCAGGAGTGGAGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985580745 Original CRISPR TTCACGCAGGAGTGGAGGAG CGG Intergenic